Enterotoxins, toxic shock syndrome toxin 1(TSST-1), exfoliative toxin (ET), haemolysins and coagulase are among various virulence factors produced by S. aureus. The enterotoxins, and TSST-1, belong to a family of superantigens. Eighteen Staphylococcal enterotoxins (SEs) have been recognized as: SEA, SEB, SEC, SED, SEE, SEG, SEH, SEI, SEJ, SEK, SEL, SEM, SEN, SEO, SEP, SEQ, SER and SEU. They are the main source of food poisoning and cause intensive intestinal peristalsis [9]. The present study aimed to identify the types of spa, SCCmec and the virulence genes among HA-MRSA isolates collected from a tertiary care hospital. Their association was examined to enhance our current knowledge of the pathogenicity and evolution of HA-MRSA.
Materials and Methods
Selection of the strains
Eighty HA-MRSA strains were isolated from unrelated patients in the First Affiliated Hospital of Soochow University from September 2013 to June 2014. This hospital has 1800 beds and serves a population of 1,000, 000 inhabitants in both urban and rural areas. These strains were obtained from sputum (71), wound swabs (9), secretions (3), Pharyngeal swabs (3), urine samples (3), body fluid (2), liquor puris (2), bone marrow (1), catheter (1) and others (1). The presence of methicillin resistance was evaluated using a cefoxitin disc (30μg; Oxoid). The presence of the resistance gene mecA was tested for PCR according to a protocol previously described [10].
Susceptibility testing
Antimicrobial susceptibility test for isolates of S. aureus was performed against cefoxitin (FOX, 30μg), penicillin (P, 10μg), ciprofloxacin (CIP, 5μg), clindamycin (DA, 30μg), sulfamethoxazole (SXT, 25μg), vancomycin (VAN, 30μg), teicoplanin (TEC, 30μg) and linezolide (LZD, 30μg) (Oxoid, UK), by the disc diffusion method. The results were interpreted according to the Clinical and Laboratory Standards Institute guidelines (CLSI- 2011) [11].
DNA isolation
All isolates were cultured on blood agar and incubated overnight at 370C. Genomic DNA was isolated from all strains with Wizard Genomic DNA purification kit (Promega, China), according to the manufacturer’s instructions and used as template for PCR.
Spa typing of strains
All HA-MRSA were characterized by comparative DNA analysis of the variable number of tandem repeats region of the S. aureus protein A (spa) gene similar to a previously described method [12], using primers spa-1095F and spa-1517R. Calculation of the type ability, diversity, and concordance of the spa typing method with the results of alternative typing methods was implemented in Ridom SpaServer software (http://spa.ridom.de/index.shtml).
SCCmec typing of strains
MRSA strains were further characterized by simplex PCR of the SCCmec gene, as described elsewhere [13].
Detection of virulence genes
The genes encoding staphylococcal enterotoxins (sea, seb, sec, sed, selR, sen, seo, sep, seq, ser, seu), tst-1, pvl and cna were performed by single PCR as previously reported [14]. The primers used in this study are listed in [Table/Fig-1].
Primers used for amplification of spa, SCCmec and Virulence genes
Primers | Oligonucleotide sequence (5’–3’) | Sizes (bp) | Specificity | Reference |
---|
Type I -F | GCTTTAAAGAGTGTCGTTACAGG | 613 | SCCmec I | [13] |
Type I-R | GTTCTCTCATAGTATGACGTCC | | | |
Type II-F | CGTTGAAGATGATGAAGCG | 398 | SCCmec II | [13] |
Type II-R | CGAAATCAATGGTTAATGGACC | | | |
Type III-F | CCATATTGTGTACGATGCG | 280 | SCCmec III | [13] |
Type III-R | CCTTAGTTGTCGTAACAGATCG | | | |
Type IVa-F | GCCTTATTCGAAGAAACCG | 776 | SCCmec IVa | [13] |
Type IVa-R | CTACTCTTCTGAAAAGCGTCG | | | |
Type IVb-F | TCTGGAATTACTTCAGCTGC | 493 | SCCmec IVb | [13] |
Type IVb-R | AAACAATATTGCTCTCCCTC | | | |
Type IVc-F | ACAATATTTGTATTATCGGAGAGC | 200 | SCCmec IVc | [13] |
Type IVc-R | TTGGTATGAGGTATTGCTGG | | | |
Type IVd-F | CTCAAAATACGGACCCCAATACA | 881 | SCCmec IVd | [13] |
Type IVd-R | TGCTCCAGTAATTGCTAAAG | | | |
Type V-F | GAACATTGTTACTTAAATGAGCG | 325 | SCCmec V | [13] |
Type V-R | TGAAAGTTGTACCCTTGACACC | | | |
1095F | AGACGATCCTTCGGTGAGC | | spa typing | [13] |
1517R | GCTTTTGCAATGTCATTTACTG | | | |
pvl-F | ATCATTAGGTAAAATGTCTG GACATGATCCA | 433 | pvl | [14] |
pvl-R | GCATCAASTGTATTGGATA GCAAAAGC | | | |
tst-F | ACCCCTGTTCCCTTATCATC | 326 | tst | [14] |
tst-R | TTTTCAGTATTTGTAACGCC | | | |
cna-F | GTCAAGCAGTTATTAACA CCAGAC | 423 | cna | [15] |
cna-R | AATCAGTAATTGCACTTTG TCCACTG | | | |
sea-F | GGTTATCAATGTGCGGGTGG | 102 | sea | [10] |
sea-R | CGGCACTTTTTTCTCTTCGG | | | |
seb-F | GTATGGTGGTGTAACTGAGC | 164 | seb | [10] |
seb-R | CCAAATAGTGACGAGTTAGG | | | |
sec-F | AGGTTTTTTCACAGGTCATCC | 209 | sec | [10] |
sec-R | CTTTTTTTTCTTCGGTCAATC | | | |
sed-F | CCAATAATAGGAGAAAATAAAAG | 278 | sed | [10] |
sed-R | ATTGGTATTTTTTTTCGTTC | | | |
selR-F | GGATAAAGCGGTAATAGCAG | 166 | selR | [16] |
selR-R | GTATTCCAAACACATCTAAC | | | |
sen-F | CTTCTTGTTGGACACCATCTT | 135 | sen | [17] |
sen-R | GAAATAAATGTGTAGGCTT | | | |
seo-F | AAATTCAGCAGATATTCCAT | 172 | seo | [17] |
seo-R | TTTGTGTAAGAAGTCAAGTGTAG | | | |
sep-F | ATCATAACCAACCGAATCAC | 148 | sep | [17] |
sep-R | AGAAGTAACTGTTCAGGAGCTA | | | |
seq-F | TCAGGTCTTTGTAATACAAAA | 359 | seq | [17] |
seq-R | TCTGCTTGACCAGTTCCGGT | | | |
ser-F | AGATGTGTTTGGAATACCCTAT | 123 | ser | [17] |
ser-R | CTATCAGCTGTGGAGTGCAT | | | |
seu-F | ATTTGCTTTTATCTTCAT | 167 | seu | [17] |
seu-R | GGACTTTAATGTTTGTTTCTGAT | | | |
mecA-F | ACTGCTATCCACCCTCAAAC | 147 | mecA | [10] |
mecA-R | CTGGTGAAGTTGTAATCTGG | | | |
Results
Antimicrobial Susceptibility
Overall, the resistance rates for the HA-MRSA strains were 100.0% (80/80) for cefoxitin (FOX), 100% (80/80) for penicillin (P), 93.8% (75/80) for ciprofloxacin (CIP), 62.5% (50/80) for clindamycin (DA), 13.8% (11/80) for sulfamethoxazole (SXT) [Table/Fig-2]. NO resistance to vancomycin, teicoplanin, and linezolide was found. Almost all of the isolates except four which were included in this study, were found to be resistant to three or more groups of antibiotics which were tested and five different resistant patterns were observed amongst them [Table/Fig-3]. Most strains were resistant to cefoxitin, penicillin and ciprofloxacin.
Drug resistance of the 80 HA-MRSA isolates
Antibiotics | Resistant (%) |
---|
FOX | 80(100%) |
P | 80(100%) |
CIP | 75(93.8%) |
DA | 50(62.5%) |
SXT | 11(13.8%) |
VAN | 0 |
TEC | 0 |
LZD | 0 |
Resistance patterns of the MRSA isolates
Resistance pattern | No. of isolates |
---|
FOX-P-CIP-DA-SXT | 9 |
FOX-P-CIP-DA | 40 |
FOX-P-CIP-SXT | 2 |
FOX-P-CIP | 24 |
FOX-P-DA | 1 |
FOX-P | 4 |
SCCmec typing and spa typing
The distribution of SCCmec types, spa types, virulence gene profile in isolates is shown in [Table/Fig-4]. Among the 80 HA-MRSA strains, SCCmec II, SCCmec III and SCCmec V were identified in 73.8%(59/80), 13.8%(11/80) and 12.5%(10/80) of strains, respectively.
The SCCmec type, spa type, and virulence genes profile of the 80 HA-MRSA isolates
Spa types | CCs | SCC mec | No. of positive strains |
---|
sea | seb | sec | sed | sel | sen | seo | sep | seq | ser | seu | cna | pvl | tst |
---|
t2460(28) | 5 | II | 28 | 28 | 0 | 28 | 28 | 28 | 28 | 1 | 2 | 24 | 26 | 2 | 2 | 0 |
t002(9) | 5 | II | 9 | 9 | 0 | 9 | 9 | 9 | 9 | 0 | 0 | 9 | 9 | 1 | 1 | 0 |
t632(7) | - | II | 7 | 7 | 0 | 7 | 7 | 7 | 7 | 2 | 2 | 7 | 1 | 7 | 0 | 0 |
t030(6) | 8 | II | 6 | 6 | 0 | 6 | 6 | 6 | 6 | 0 | 5 | 4 | 1 | 2 | 0 | 0 |
t437(3) | 59 | II | 3 | 3 | 0 | 3 | 3 | 3 | 3 | 1 | 2 | 2 | 0 | 0 | 2 | 0 |
t211(2) | 8 | II | 2 | 2 | 0 | 2 | 2 | 2 | 2 | 0 | 0 | 2 | 0 | 1 | 0 | 0 |
t4549(2) | - | II | 2 | 2 | 0 | 2 | 2 | 2 | 2 | 0 | 1 | 2 | 1 | 0 | 0 | 0 |
t299(1) | - | II | 1 | 1 | 0 | 1 | 1 | 1 | 1 | 0 | 0 | 1 | 1 | 0 | 0 | 0 |
t189(1) | - | II | 1 | 1 | 0 | 1 | 1 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | 0 | 0 |
t311(3) | 5 | V | 3 | 3 | 0 | 3 | 3 | 3 | 3 | 0 | 2 | 3 | 3 | 1 | 0 | 0 |
t163(2) | - | V | 2 | 2 | 0 | 2 | 2 | 2 | 2 | 0 | 2 | 1 | 2 | 2 | 0 | 0 |
t2310(2) | - | V | 2 | 2 | 0 | 2 | 2 | 2 | 2 | 2 | 0 | 2 | 1 | 0 | 0 | 0 |
t164(2) | - | V | 2 | 2 | 0 | 2 | 2 | 2 | 2 | 0 | 0 | 2 | 2 | 1 | 0 | 0 |
t377(1) | - | V | 1 | 1 | 0 | 1 | 1 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | 0 | 0 |
t037(5) | 8 | III | 5 | 5 | 0 | 5 | 5 | 5 | 5 | 0 | 0 | 3 | 2 | 1 | 1 | 0 |
t264(2) | - | III | 2 | 2 | 0 | 2 | 2 | 2 | 2 | 0 | 0 | 2 | 1 | 1 | 0 | 0 |
t279(2) | - | III | 2 | 2 | 0 | 2 | 2 | 2 | 2 | 0 | 0 | 2 | 1 | 0 | 0 | 0 |
t459(1) | - | III | 1 | 1 | 0 | 1 | 1 | 1 | 1 | 0 | 1 | 1 | 1 | 1 | 0 | 0 |
t034(1) | - | III | 1 | 1 | 0 | 1 | 1 | 1 | 1 | 0 | 0 | 1 | 1 | 1 | 0 | 0 |
Total(80) | | | 80 (100.0%) | 80 (100.0%) | 0 | 80 (100.0%) | 80 (100.0%) | 80 (100.0%) | 80 (100.0%) | 8 (10.0%) | 17 (21.3%) | 74 (92.5) | 54 (67.5%) | 21 (26.2%) | 6 (7.5%) | 0 |
There were 19 different spa types (t2460, t002, t632, t030, t437, t211, t4549, t299, t189, t311, t163, t2310, t164, t377, t037, t264, t279, t459 and t034) [Table/Fig-4]. Spa type t2460 were the most prevalent one (35.0%, 28/80), followed by spa type t002 (11.3%, 9/80). The prevalence of t2460 was thought to be an outbreak. It was previously reported that t002, t311, and t2460 were linked to MLST CC5, and t030, t211 and t037 were associated with CC8 [18,19]. CC5 is one of the major MLST CCs type (50%, 40/80) in Suzhou.
Virulence factors genes analysis
The presence of 14 virulence genes was in all 80 HA-MRSA isolates. The most frequent toxin genes were sea, seb, sed, sel, sen and seo (100.0%, 80/80), followed by ser (92.5 %, 74/80), seu (67.5%, 54/80), cna (26.2%, 21/80), seq (21.3%, 17/80), sep (10.0%, 8/80) and pvl (7.5%, 6/80) [Table/Fig-4]. But none of the investigated isolates carried the sec or tst.
The enterotoxin gene cluster is always present in MLST CC5, CC22, and CC45 strains but not in CC8, CC12, CC15, and CC395 [20]. The results that CC5 is the major MLST CC type (50%) showed that distribution of the virulence gene cluster in our study is similar to that of previous findings.
Discussion
Virulence and resistance are two important pathogenic character-istics. Strains with different virulence factors commonly display different level of pathogenicity. Genetic background and virulence differs in different geographic regions. This study was conducted to investigate the virulence characteristics and the presence of virulent genes in HA-MRSA from China. Wu et al., reported that the SAg genes presence of exfoliative toxin genes in CA-MRSA isolates collected from Chinese children [21]. The common toxin gene combination was seb-sek-seq, with 92.6% found in CC59 [21]. Our results displayed that the most common toxin gene combination was sea-seb-sed-sel-sen-seo-ser (100.0%, 80/80), with 50% found in MLST CC5. Previous study showed that SEA and SEC tend to trigger T-cell proliferation and induce higher inflammatory responses resulting in host tissue damage than do other enterotoxins [18]. In this study, we did not find the existence of sec in Suzhou isolates. Similar results were also observed in a previous study [22]. This implied that the virulence characteristics between HA-MRSA and CA-MRSA were different and there may be different evolutionary mechanism underling this. Further investigation is required.
Researches based on spa typing exhibited that the predominant HA-MRSA clone was t2460-MRSA in Asian countries besides Japan and South Korea (MLST CC5) [23,24]. Our study displayed the same results among the 80 HA-MRSA isolates (35.0%, 28/80). Shipeng Li et al., [25] and Yanghong Qiao et al., [26] reported that the predominant spa-type in MRSA isolated from Chinese children was t437. MRSA isolated from children may be community acquired MRSA (CA-MRSA). Hang Cheng et al., [27] found that the prevalent spa-type was t030. However, only three strains were spa-type t437 and six strains were spa-type t030 in the study. This implied that the prevalent spa types between HA-MRSA and CA-MRSA may be different. It was previously reported that t002, t601, and t2460 are linked to MLST CC5, and t037 is associated with CC8 [25]. In the study, the CC5 isolates accounted for 50% (40/80) of the representative strains [Table/Fig-4]. [Table/Fig-4] showed that t2460(35%, 28/80), t002(11.3%, 9/80), t632(8.8%, 7/80) and t030(7.5%, 6/80) were the common spa types in Suzhou isolates. It was previously reported that the genetic background is closely related to virulence factors [28]. The enterotoxin gene cluster is always present in MLST CC5, CC22, and CC45 strains but not in CC8, CC12, CC15, and CC395 [17]. Our study displayed CC5 was the major MLST CC type (50%). Therefore, the distribution of the virulence gene cluster in our study is similar to that of previous findings.
Conclusion
In summary, Genotypic and virulence evaluation of the HA-MRSA revealed that the isolates with CC5 and SCCmec II were the predominant type and highly homological. The virulence profiles mainly existed in the genes of sea, seb, sed, sel, sen, seo and ser. The prevalence of t2460 was an outbreak and the predominant spa type. The prevalence of enterotoxin genes and spa genotypes of HA-MRSA explored in this study enhance our current knowledge of the pathogenicity and genetic characteristics of MRSA. Moreover, investigating the prevalence of enterotoxin genes and spa genotypes of HA-MRSA is crucial for infection control and appropriate therapy.