Microbiology Section DOI : 10.7860/JCDR/2015/13234.6157

Year : 2015 | Month : Jul | Volume : 9 | Issue : 7

Full Version Page : DC01 - DC04

Phylogenetic Distribution of Virulence Genes Among ESBL-producing Uropathogenic Escherichia coli Isolated from Long-term Hospitalized Patients

Ruike Zhao¹, Jinfang Shi², Yimin Shen³, Yanmeng Li⁴, Qingzhen Han⁵, Xianfeng Zhang⁶, Guohao Gu⁷, Jie Xu⁸

¹ Faculty, Department of Clinical Laboratory, the First Affiliated Hospital of Soochow University, Suzhou, P.R. of China.
² Faculty, Department of Clinical Laboratory, the First Affiliated Hospital of Soochow University, Suzhou, P.R. of China.
³ Faculty, Department of Clinical Laboratory, the First Affiliated Hospital of Soochow University, Suzhou, P.R. of China.
⁴ Faculty, Department of Clinical Laboratory, the First Affiliated Hospital of Soochow University, Suzhou, P.R. of China.
⁵ Faculty, Department of Clinical Laboratory, the First Affiliated Hospital of Soochow University, Suzhou, P.R. of China.
⁶ Faculty, Department of Clinical Laboratory, the First Affiliated Hospital of Soochow University, Suzhou, P.R. of China.
⁷ Faculty, Department of Clinical Laboratory, the First Affiliated Hospital of Soochow University, Suzhou, P.R. of China.
⁸ Faculty, Department of Clinical Laboratory, the First Affiliated Hospital of Soochow University, Suzhou, P.R. of China.

NAME, ADDRESS, E-MAIL ID OF THE CORRESPONDING AUTHOR: Dr. Jie Xu, Faculty, Department of Clinical Laboratory, the First Affiliated Hospital of Soochow University, No. 188, Shizijie, Canglang District, Suzhou-215006, P.R. China.
E-mail: xuj2007@lzu.edu.cn

Abstract

Objectives

The present study was aimed to investigate the antibiotic resistance, virulence potential and phylogenetic grouping of ESBL-producing uropathogenic Escherichia coli (EP-UPEC) isolated from long-term hospitalized patients.

Materials and Methods

EP-UPEC isolates from September 2013 to June 2014 at a tertiary care hospital of China were screened for ESBL-production by the double disk diffusion test. Isolates with ESBL-phenotype were further characterized by antibiotic resistance testing, PCR of different ESBL and virulence genes, and phylogenetic grouping.

Results

One hundred and twenty EP-UPEC were isolated from long-term hospitalized patients. All EP-UPEC isolates were resistant to Ampicillin, Cefazolin, Cefuroxime, Cefotaxime, Cefoperazone and Ceftriaxone, and the majority of EP-UPEC isolates were resistant to Piperacillin (82.5%), Ciprofloxacin (81.2%), Trimethoprim-Sulfamethoxazole (72.5%). The isolates showed the highest sensitivity against Imipenem (98.4%), Piperacillin/tazobactam (96.7%), Cefoperazone/sulbactam (91.7%), Amikacin (90.8%) and Cefepime (75.8%). Nine different ESBL genotype patterns were observed and CTX-M type was the most prevalent ESBL genotype (42.5%, 51/120). Majority of EP-UPEC isolates possess more than one ESBL genes. EP-UPEC isolates belonged mainly to phylogenetic group B2(36.7%) and D(35.0%). The prevalence of traT, ompT, iss, PAI, afa, fimH and papC were 75.8%, 63.3%, 63.3%, 60.8%, 40.8%, 19.2% and 6.7%, respectively. The number of virulence genes (VGs) detected was significantly higher in group B2 than in group A (ANOVA, p<0.001), group B1(ANOVA, p= 0.012) and D (ANOVA, p<0.001).

Conclusions

EP-UPEC strains showed multidrug resistance and co-resistance to other non β-lactam antibiotics. CTX-M was the most prevalent ESBL genotype and majority of EP-UPEC strains more than one ESBL genes. EP-UPEC strains belonged mainly to phylogenetic group B2 and D, and most of the virulence genes were more prevalent in group B2.

Keywords

ESBL,Phylogenetic groups,Resistance,UPEC,Virulence

Introduction

Urinary tract infection (UTI) is one of the most common bacterial infections, and UPEC is the causative pathogen over 50% nosocomial UTI [1].The production of ESBLs is a common resistant mechanism of UPEC [2]. Cases of UTI caused by ESBL-producing E.coli are increasing. Among ESBL genes, CTX-M, TEM, SHV and OXA are the major clinical concern, and ESBL-producing E.coli is prevalent in several countries in Asia region [3–5]. Antibacterial choice is often complicated by multidrug resistance. There is an increasing association between ESBL production and multidrug resistance.

Acquisition of potential virulence factors by UPEC strains might increase their ability to adapt to new niches, contribute to colonization and invasion into host tissues, avoidance to immune responses and acquiring nutrients from the host [6–8].The virulence genes include adhesion (afa, sfa, fimH and papC), protectin (traT and iss), toxin (cnf1 and hlyA) and siderophore (iutA), iucC and ompT (6-8). Afa is associated with pyelonephritis, and recurrent and chronic UTI [9]. Hly gene is associated with pyelonephritis and plays a role in lysing nucleated host cells and damaging immune cells [10].

E.coli strains are divided into four main phylogenetic groups: A, B1, B2 and D, and the most E.coli strains responsible for UTI belong to group B2 and D [11]. The distribution of phylogenetic groups in different geographic regions may vary.

The purpose of this study was to assess correlating antibiotic resistance, virulence potential and phylogenetic groups of ESBL-producing uropathogenic E.coli (EP-UPEC) isolated from long-term hospitalized patients.

Materials and Methods

Selection of the Strains

A total of 120 ESBL-producing UPEC strains were isolated from long-term hospitalized patients in the First Affiliated Hospital of Soochow University from September 2013 to June 2014. This hospital has 1800 beds and serves a population of 1,000,000 inhabitants in both urban and rural areas. These strains were obtained from urine samples. The presence of ESBL resistance was evaluated using the Ceftazidime and Ceftazidime-Clavulanic Acid (CAC) and the Cefotaxime and Cefotaxime-Clavulanic Acid (CEC) combination disks.

Susceptibility Testing

Antimicrobial susceptibility test for isolates of Escherichia coli was performed against trimethoprim-Sulfamethoxazole (30μg), Ampicillin (10μg), Gentamicin (10μg), Cefazolin (CZO), Cefuroxime (30μg), Cefotaxime (30μg), Ceftriaxone (30μg), Cefoperazone (30μg), Ceftazidime (CAZ), Cefepime (30μg), Cefoperazone/sulbactam (75/30μg), Piperacillin (100μg), Piperacillin/tazobactam (100/10μg), Amikacin (30μg), Ciprofloxacin (5μg), Imipenem (10μg) (Oxoid, UK), by the disc diffusion method. The results were interpreted according to the Clinical and Laboratory Standards Institute guidelines (CLSI-2011).The resistant genes of SHV, TEM, CTM-M and OXA were identified. All the primer sequences used have been used in previous studies [12].

DNA Isolation

All isolates were cultured on blood agar and incubated overnight at 37°C. Genomic DNA was isolated from all strains with Wizard Genomic DNA purification kit (Promega, China), according to the manufacturer’s instructions, and used as template for PCR.

Phylogenetic Grouping Typing of Strains and Detection of Virulence Genes

Phylogenetic grouping typing was performed as described previously [11].The genes encoding Escherichia coli virulence genes (traT, papC, hlyA, iutA (aerJ), sfa, afa, cnf1, fimH, PAI, iucC, iss, and ompT), were performed by single PCR as previously reported [13–18]. The primers used in this study are listed in [Table/Fig-1].

[Table/Fig-1]:

Primers used for amplification of ESBL, Phylogenetic grouping and Virulence genes

Primers	Oligonucleotide sequence (5'–3')	Sizes (bp)	Specificity	Reference
ESBLs
SHV-F	GGTTATGCGTTATATTCGCC	865	SHV	[12]
SHV-R	TTAGCGTTGCCAGTGCTC
TEM-F	ATGAGTATTCAACATTTCCG	868	TEM	[12]
TEM-R	CTGACAGTTACCAATGCTTA
CTX-M-F	ATGTGCAGYACCAGTAARGT	593	CTM-M	[12]
CTM-M-R	TGGGTRAARTARGTSACCAGA
OXA-F	ACACAATACATATCAACTTCGC	814	OXA	[12]
OXA-R	AGTGTGTTTAGAATGGTGATC
phylogentic group
chuA-F	GACGAACCAACGGTCAGGAT	279	chuA	[11]
chuA-R	TGCCGCCAGTACCAAAGACA
yjaA-F	TGAAGTGTCAGGAGACGCTG	211	yjaA	[11]
yjaA-R	ATGGAGAATGCGTTCCTCAAC
tspE4C2-F	GAGTAATGTCGGGGCATTCA	152	spE4C2	[11]
tspE4C2-R	CGCGCCAACAAAGTATTACG
Virulent genes
traT-F	GGTGTGGTGCGATGAGCACAG	290	traT	[13]
traT-R	CACGGTTCAGCCATCCCTGAG
papC-F	GACGGCACTGCTGCAGGGTGTGGCG	328	papC	[15]
papC-R	ATATCCTTTCTGCAGGGATGCAATA
hlyA-F	AACAAGGATAAGCACTGTTCTGGCT	1177	hlyA	[14]
hlyA-R	ACCATATAAGCGGTCATTCCCGTCA
iutA-F	ATGAGCATATCTCCGGACG	587	iutA (aerJ)	[16]
iutA-R	CAGGTCGAAGAACATCTGG
sfa-F	CTCCGGAGAACTGGGTGCATCTTAC	410	sfa	[14]
sfa-R	CGGAGGAGTAATTACAAACCTGGCA
afa-F	GCTGGGCAGCAAACTGATAACTCTC	750	afa	[14]
afa-R	CATCAAGCTGTTTGTTCGTCCGCCG
cnf1-F	AAGATGGAGTTTCCTATGCAGGAG	498	cnf1	[14]
cnf1-R	TGGAGTTTCCTATGCAGGAG
fimH-F	TGTACTGCTGATGGGCTGGTC	564	fimH	In the study
fimH-R	GGGTAGTCCGGCAGAGTAACG
PAI-F	GGACATCCTGTTACAGCGCGCA	930	PAI	[17]
PAI-R	TCGCCACCAATCACAGCCGAAC
iucC-F	AAACCTGGCTTACGCAACTGT	269	iucC	[15]
iucC-R	ACCCGTCTGCAAATCATGGAT
iss-F	GTGGCGAAAACTAGTAAAACAGC	760	iss	[18]
iss-R	CGCCTCGGGGTGGATAA
ompT-F	ATCTAGCCGAAGAAGGAGGC	559	ompT	[18]
ompT-R	CCCGGGTCATAGTGTTCATC

Statistical Analysis

All data were analysed using IBM SPSS 21.0 statistical software. A p-value less than 0.05 was considered statistically significant.

Results

A total number of 120 ESBL-producing UPEC (EP-UPEC) were isolated from long-term hospitalized patients. The distribution of the ESBL groups and the resistant profiles of EP-UPEC isolates are summarized in [Table/Fig-2]. The disk diffusion indicated the resistant rates for the EP-UPEC isolates were 100.0% (120/120) for Ampicillin, Cefazolin, Cefuroxime, Cefotaxime, Cefoperazone and Ceftriaxone, and the majority of EP-UPEC isolates were resistant to Piperacillin (82.5%), Ciprofloxacin (81.2%), Trimethoprim-Sulfamethoxazole (72.5%) Gentamicin (54.2%) and Ceftazidime (44.2%). The isolates showed the highest sensitivity against Imipenem (98.4%), Piperacillin/tazobactam (96.7%), Cefoperazone/sulbactam (91.7%), Amikacin (90.8%) and Cefepime (75.8%). Analysis of antibacterial resistant patterns showed that EP-UPEC isolates were more frequently co-resistant to other non-beta lactam classes of antibiotics.

[Table/Fig-2]:

Drug resistance and ESBLs of EP-ESBLs

Antibiotics	Resistant (%)
Ampicillin	100.0
Cefazolin	100.0
Cefuroxime	100.0
Cefotaxime	100.0
Ceftriaxone	100.0
Cefoperazone	100.0
Trimethoprim-Sulfamethoxazole	87 (72.5)
Ciprofloxacin	98 (81.2)
Gentamicin	65 (54.2)
Cefepime	29 (24.2)
Ceftazidime	53 (44.2)
Cefoperazone/sulbactam	10 (8.3)
Piperacillin	99 (82.5)
Piperacillin/tazobactam	4 (3.3)
Amikacin	11 (9.2)
Imipenem	2(1.6)
ESBL genes
CTX-M	109(90.8)
TEM	48(40.0)
SHV	13(10.8)
OXA	12(10.0)

CTX-M, TEM, SHV and OXA were identified in 90.8% (109/120), 40.0% (48/120), 10.8% (13/120) and10.0% (12/120) of EP-UPEC strains, respectively [Table/Fig-2]. Moreover, nine different ESBL genotype patterns were observed amongst them [Table/Fig-3]. CTX-M type was the most prevalent ESBL genotype (42.5%, 51/120), and majority of EP-UPEC isolates possess more than one ESBL genes.

[Table/Fig-3]:

Distribution of ESBL genotypes in EP-UPEC isolates

ESBL genotypes	No. of isolates
CTX-M,TEM,SHV	6 (5.0)
CTX-M,TEM	36 (30.0)
CTX-M,SHV	6 (5.0)
CTX-M,OXA	10 (8.3)
TEM,OXA	1 (0.8)
CTX-M	51 (42.5)
TEM	5 (4.2)
SHV	1 (0.8)
OXA	1 (0.8)

All EP-UPEC isolates for the presence of 12 virulence genes (VGs) was tested. Of 120 EP-UPEC isolates, 110(91.7%) were iucC, and 75.8%, 63.3%, 63.3%, 60.8%, 40.8%, 19.2% and 6.7% of isolates were positive for traT, ompT, iss, PAI, afa, fimH and papC, respectively [Table/Fig-4]. The cnf1, sfa, intA and hlyA products were not detected in any of the isolates.

[Table/Fig-4]:

Distribution ofVirulence genes in EP-UPEC isolates

virulence genes	No. of isolates
iucC	110(91.7)
PAI	73(60.8)
fimH	23(19.2)
afa	49(40.8)
traT	91(75.8)
ompT	76(63.3)
iss	76(63.3)
papC	8(6.7)

The distribution of phylogenetic types in isolates is shown in [Table/Fig-5]. Among the 120 EP-UPEC strains, A type, B1 type, B2 type and D type were identified in 14.2% (17/120), 14.2% (17/120), 36.7% (44/120) and 35.0% (42/120) of strains, respectively. The EP-UPEC strains belonged mostly to phylogenetic type B2 (36.7%) and D (35.0%). Comparison of resistance number revealed that there were no significant differences among there four phylogroups [Table/Fig-6].The number of VGs detected varied within the phylogroups and was significantly higher in group B2 than in group A (ANOVA, p<0.001), group B1(ANOVA, p= 0.012) and D (ANOVA, p<0.001). Most of the virulence genes were found to be more prevalent in group B2 [Table/Fig-6]. In group B2, iucC, PAI, af aompT and fimH were prevalent as compared to the other three groups.

[Table/Fig-5]:

Distribution of Phylogroups in EP-UPEC isolates

Phylogroups	No. of isolates
A	17(14.2)
B1	17(14.2)
B2	44(36.7)
D	42(35.0)

[Table/Fig-6]:

Distribution of resistance pattern and virulence genes in groups A, B1, B2 and D

Resistance pattern	A(n=17)	B1(n=17)	B2(n=44)	D(n=42)	Total(n=120)
Trimethoprim-Sulfamethoxazole	14(82.4)	16(94.1)	32(72.7)	25(59.5)	87(72.5)
Ciprofloxacin	13(76.5)	14(82.4)	34(77.3)	37(88.1)	98(81.2)
Gentamicin	11(64.7)	7(41.2)	23(52.3)	24(57.1)	65(54.2)
Cefepime	8(47.1)	2(11.8)	7(15.9)	12(28.6)	29(24.2)
Ceftazidime	12(70.6)	9(52.7)	14(31.8)	18(42.9)	53(44.2)
Cefoperazone/sulbactam	1(5.9)	1(5.9)	4(9.1)	4(9.5)	10(8.3)
Piperacillin	14(82.4)	15(88.2)	33(75.0)	37(88.1)	99(82.5)
Piperacillin/tazobactam	2(11.8)	1(5.9)	0	1(2.4)	4(3.3)
Amikacin	2(11.8)	3(17.6)	2(4.5)	4(9.5)	11(9.2)
Imipenem	0	1(5.9)	1(2.3)	0	2(1.6)
virulence genes
iucC	16(94.1)	14(82.4)	44(100.0)	36(85.7)	110(91.7)
PAI	3(17.6)	6(35.3)	42(95.5)	22(52.4)	73(60.8)
fimH	2(11.8)	2(11.8)	13(29.5)	6(14.3)	23(19.2)
afa	8(47.1)	6(35.3)	24(54.5)	11(26.2)	49(40.8)
traT	9(52.9)	15(88.2)	31(70.5)	36(85.7)	91(75.8)
ompT	7(41.2)	10(58.8)	41(93.2)	18(42.9)	76(63.3)
iss	9(52.9)	14(82.4)	21(47.7)	32(76.2)	76(63.3)
papC	0	0	3(6.8)	5(11.9)	8(6.7)

Discussion

This study was conducted to investigate the antibiotic resistance, virulence potential and phylogenetic grouping of EP-UPEC isolated from long-term hospitalized patients. In our research, EP-UPEC isolates showed multidrug resistance or extreme drug resistance to Ampicillin, first-generation Cephalosporin, second-generation Cephalosporin and third-generation Cephalosporin. Moreover, EP-UPEC isolates showed co-resistance to other non β-lactam antibiotics like Ciprofloxacin, Piperacillin, Trimethoprim-Sulfamethoxazole and Gentamicin. Conversely, highest susceptibility was found to Imipenem (98.4%), Piperacillin/tazobactam (96.7%), Cefoperazone/sulbactam (91.7%), Amikacin (90.8%) and Cefepime (75.8%). Other studies also demonstrated that ESBL-producing E.coli strains were high resistant Ciprofloxacin, Piperacillin, Trimethoprim-Sulfamethoxazole and Gentamicin, and higher susceptive to carbapenems and Amikacin [19–21].

ESBL genotyping results showed that UPEC isolates carried different type ESBL genes, and 90.8% were CTX-M-positive. Moreover, nine different ESBL genotype patterns were observed amongst them. Similar to other studies [22–24], we found that CTX-M type was the most prevalent ESBL genotype (42.5%, 51/120), and majority of EP-UPEC isolates possess more than one ESBL genes. Therefore, the possible role of these genes either alone or in combination for ESBL cannot be ruled out. E.coli strains are divided into four main phylogenetic groups designed A, B1, B2 and D, and the most E.coli strains responsible for UTI belong to group B2 and D [11]. In the study, phylogenetic grouping revealed that EP-UPEC isolates belonged mainly to phylogenetic group B2 (36.7%) and D (35.0%). As reported previously, most of the uropathogenic E.coli isolates belonged to the phylogenetic group B2, D [25] and most of VGs were more prevalent in phylogenetic group B2 and/or D [26–29]. In the study, the number of VGs detected varied within the phylogroups and was significantly higher in group B2 than in other three groups. Most of the virulence genes were found to be more prevalent in group B2, which is concordant with previous studies [26,27,29]. In group B2, iucC, PAI, afa, ompT and fimH were prevalent than in the other three groups, concordant with previous studies [30]. These results indicate that virulent and pathogenic E.coli isolates are usually associated with phylogenetic group B2.

Conclusion

This study indicates that EP-UPEC strains show multidrug resistance, and co-resistance to other non β-lactam antibiotics. CTX-M is the most prevalent ESBL genotype and majority of EP-UPEC strains more than one ESBL genes. EP-UPEC strains belong mainly to phylogenetic group B2 and D, and most of the virulence genes are more prevalent in group B2.These results suggest that resistance, virulence and phylogenetic groups are three different mechanisms for the outcome of EP-UPEC infection. Phylogenetic distribution of virulence genes among ESBL-producing uropathogenic E.coli isolated from long-term hospitalized patients in the study enhanced our current knowledge of the resistance, the pathogenicity and genetic characteristics of EP-UPEC. Moreover, determining the correlation of resistance, virulence and phylogenetic groups is crucial for the prevention and control of nosocomial UTI caused by ESBL-producing E.coli.

References

[1]. Toval F, Köhler CD, Vogel U, Wagenlehner F, Mellmann A, Fruth A, Characterization of Escherichia coli isolates from hospital inpatients or outpatients with urinary tract infection J Clin Microbiol 2014 52(2):407-18.  [Google Scholar]

[2]. Talbot GH, Bradley J, Edwards JE, Gilbert D, Scheld M, Bartlett JG, Bad bugs need drugs: an update on the development pipeline from the Antimicrobial Availability Task Force of the Infectious Diseases Society of America Clin Infect Dis 2006 42(5):657-68.  [Google Scholar]

[3]. Heffernan HM, Woodhouse RE, Pope CE, Blackmore TK, Prevalence and types of extended-spectrum β-lactamases among urinary Escherichia coli and Klebsiella spp. in New Zealand Int J Antimicrob Ag 2009 34(6):544-49.  [Google Scholar]

[4]. Yu Y, Ji S, Chen Y, Zhou W, Wei Z, Li L, Resistance of strains producing extended-spectrum β-lactamases and genotype distribution in China J Infection 2007 54(1):53-57.  [Google Scholar]

[5]. Chong Y, Yakushiji H, Ito Y, Kamimura T, Clinical and molecular epidemiology of extended-spectrum β-lactamase-producing Escherichia coli and Klebsiella pneumoniae in a long-term study from Japan Eur J Clin Microbiol 2011 30(1):83-7.  [Google Scholar]

[6]. Kaper JB, Nataro JP, Mobley HL, Pathogenic escherichia coli Nat Rev Microbiol 2004 2(2):123-40.  [Google Scholar]

[7]. Pitout JD, Extraintestinal pathogenic Escherichia coli: a combination of virulence with antibiotic resistance Frontiers in Microb 2012 3:e00009  [Google Scholar]

[8]. Köhler CD, Dobrindt U, What defines extraintestinal pathogenic Escherichia coli? Int J Med Microbiol 2011 301(8):642-47.  [Google Scholar]

[9]. Le Bouguénec C, Adhesins and invasins of pathogenic Escherichia coli Int J Med Microbiol 2005 295(6):471-78.  [Google Scholar]

[10]. Los FC, Randis TM, Aroian RV, Ratner AJ, Role of pore-forming toxins in bacterial infectious diseases Microbiol Mol Biol R 2013 77(2):173-207.  [Google Scholar]

[11]. Clermont O, Bonacorsi S, Bingen E, Rapid and Simple Determination of the Escherichia coli Phylogenetic Group Appl. Environ. Microb 2000 66(10):4555-58.  [Google Scholar]

[12]. Lim KT, Yeo CC, Yasin RM, Balan G, Thong KL, Characterization of multidrug-resistant and extended-spectrum β-lactamase-producing Klebsiella pneumoniae strains from Malaysian hospitals J. Med. Microbiol 2009 58(11):1463-69.  [Google Scholar]

[13]. Johnson JR, Kuskowski MA, Owens K, Gajewski A, Winokur PL, Phylogenetic origin and virulence genotype in relation to resistance to fluoroquinolones and/or extended-spectrum cephalosporins and cephamycins among Escherichia coli isolates from animals and humans J Infect Dis 2003 188(5):759-68.  [Google Scholar]

[14]. Dormanesh B, Dehkordi FS, Hosseini S, Momtaz H, Mirnejad R, Hoseini MJ, Virulence Factors and O-Serogroups Profiles of Uropathogenic Escherichia Coli Isolated from Iranian Pediatric Patients Iranian Red Crescent medical J 2014 16(2):e14627  [Google Scholar]

[15]. Asadi S, Kargar M, Solhjoo K, Najafi A, Ghorbani-Dalini S, The Association of Virulence Determinants of Uropathogenic Escherichia coli With Antibiotic Resistance Jundishapur J Microbiol 2014 7(5):e9936  [Google Scholar]

[16]. Tramuta C, Robino P, Nucera D, Salvarani S, Banche G, Malabaila A, Molecular characterization and antimicrobial resistance of faecal and urinary Escherichia coli isolated from dogs and humans in Italy Veterinaria Italiana 2014 50(1):23-30.  [Google Scholar]

[17]. Sabaté M, Moreno E, Perez T, Andreu A, Prats G, Pathogenicity island markers in commensal and uropathogenic Escherichia coli isolates Clinical Microbiology and Infection 2006 12(9):880-86.  [Google Scholar]

[18]. Derakhshandeh A, Firouzi R, Motamedifar M, Motamedi Boroojeni A, Bahadori M, Arabshahi S, Distribution of virulence genes and multiple drug-resistant patterns amongst different phylogenetic groups of uropathogenic Escherichia coli isolated from patients with urinary tract infection Lett Appl Microbiol 2015 60(2):148-54.  [Google Scholar]

[19]. Goyal A, Prasad K, Prasad A, Gupta S, Ghoshal U, Ayyagari A, Extended spectrum β-lactamases in Escherichia coli & Klebsiella pneumoniae & associated risk factors Indian J Med Res 2009 :695-700.  [Google Scholar]

[20]. Al-Zarouni M, Senok A, Rashid F, Al-Jesmi SM, Panigrahi D, Prevalence and antimicrobial susceptibility pattern of extended-spectrum beta-lactamase-producing Enterobacteriaceae in the United Arab Emirates Med Prin Pract 2008 17(1):32-36.  [Google Scholar]

[21]. Maina D, Makau P, Nyerere A, Revathi G, Antimicrobial resistance patterns in extended-spectrum β-lactamase producing Escherichia coli and Klebsiella pneumoniae isolates in a private tertiary hospital, Kenya Microbiol. Discovery 2013 1(1):5  [Google Scholar]

[22]. Chakraborty A, Adhikari P, Shenoy S, Saralaya V, Clinical significance and phylogenetic background of extended spectrum β-lactamase producing Escherichia coli isolates from extra-intestinal infections J Infect Public Health 2014   [Google Scholar]

[23]. Pournaras S, Ikonomidis A, Kristo I, Tsakris A, Maniatis AN, CTX-M enzymes are the most common extended-spectrum β-lactamases among Escherichia coli in a tertiary Greek hospital J. Antimicrob. Chemoth 2004 54(2):574-75.  [Google Scholar]

[24]. Radice M, Power P, Di Conza J, Gutkind G, Early dissemination of CTX-M-derived enzymes in South America Antimicrob Agents Ch 2002 46(2):602-4.  [Google Scholar]

[25]. Abdi HA, Rashki A, Comparison of Virulence Factors Distribution in Uropathogenic E. coli Isolates From Phylogenetic Groups B2 and D Int J Enteric Pathog 2014 2(4):e21725  [Google Scholar]

[26]. Rodríguez-Baño J, Mingorance J, Fernández-Romero N, Serrano L, López-Cerero L, Pascual A, Virulence profiles of bacteremic extended-spectrum β-lactamase-producing Escherichia coli: association with epidemiological and clinical features PloS one 2012 7(9):e44238  [Google Scholar]

[27]. Johnson JR, Delavari P, Kuskowski M, Stell AL, Phylogenetic distribution of extraintestinal virulence-associated traits in Escherichia coli J Infect Dis 2001 183(1):78-88.  [Google Scholar]

[28]. Ramos N, Saayman ML, Chapman T, Tucker J, Smith H, Faoagali J, Genetic relatedness and virulence gene profiles of Escherichia coli strains isolated from septicaemic and uroseptic patients Eur J Clin Microbiol 2010 29(1):15-23.  [Google Scholar]

[29]. Lee S, Yu JK, Park K, Oh EJ, Kim SY, Park YJ, Phylogenetic groups and virulence factors in pathogenic and commensal strains of Escherichia coli and their association with blaCTX-M Ann Clin Lab Sci 2010 40(4):361-67.  [Google Scholar]

[30]. Lillo J, Pai K, Balode A, Makarova M, Huik K, Kõljalg S, Differences in Extended-Spectrum Beta-Lactamase Producing Escherichia coli Virulence Factor Genes in the Baltic Sea Region Biomed Res Int 2014 :e427254  [Google Scholar]