JCDR - Register at Journal of Clinical and Diagnostic Research
Journal of Clinical and Diagnostic Research, ISSN - 0973 - 709X
Oncology Section DOI : 10.7860/JCDR/2016/22796.8985
Year : 2016 | Month : Dec | Volume : 10 | Issue : 12 Full Version Page : XC01 - XC04

BCL6 mRNA Expression Level in Invasive Duct Carcinoma not otherwise Specified

Eman Badr1, Eman Masoud2, Asmaa Gaber Abdou3, Marwa Serag Eldien4

1 Assistant Professor, Department of Biochemistry, Shebein Elkom, Menoufia, Egypt.
2 Lecturer, Department of Biochemistry, Shebein Elkom, Menoufia, Egypt.
3 Professor, Department of Pathology, Shebein Elkom, Menoufia, Egypt.
4 Lecturer, Department of Pathology, Shebein Elkom, Menoufia, Egypt.


NAME, ADDRESS, E-MAIL ID OF THE CORRESPONDING AUTHOR: Dr. Asmaa Abdou, Professor, Department of Pathology, Shebein Elkom, Menoufia, Egypt.
E-mail: asmaa_elsaidy@yahoo.com
Abstract

Introduction

B-Cell Lymphoma 6 (BCL6) has an oncogenic role in tumourigenesis of various malignancies. It represses genes involved in terminal differentiation and plays complementary role with Signal Transducer and Activator of Transcription 3 (STAT3) in triple-negative breast cancer cellular function.

Aim

To evaluate the expression of BCL6 in cancer breast and determine its correlation with the clinico-pathological features including the molecular subtype of breast carcinoma.

Materials and Methods

This prospective case control study was carried out on 150 patients, divided into 100 cases of invasive duct carcinoma not otherwise specified and 50 benign breast lesions including fibroadenoma and fibrocystic disease. Fresh tissues were excised, which were then subjected to RNA extraction. The BCL6 mRNA level was assessed using real-time reverse transcription Polymerase Chain Reaction (PCR).

Results

There was a significant higher levels of BCL6 mRNA in malignant cases compared to benign ones (p<0.001). The level of BCL6 mRNA was higher in cases showing advanced tumor stage (p<0.04), triple negative subtype and associated in situ component (p<0.001) compared to cases with an early stage, luminal or Her 2-neu positive subtypes and those lacking in situ component.

Conclusion

BCL6 is up-regulated in breast cancer and is associated with poor prognostic features such as advanced stage and triple negative molecular subtype. BCL6 inhibitors might be considered as targeted therapy for breast cancer.

Keywords

Breast cancer,Polymerase chain reaction,Target therapy,Stage,Triple negative

Introduction

Breast cancer is the fifth most common leading cause of cancer death in women. The burden of breast cancer exceeds all other cancers and the incidence rates of breast cancer are increasing [1]. Breast cancer ranks as number one among all malignant tumors in Egypt accounting for 17.5% and it represents a biologically more aggressive disease than that encountered in the West [2].

Breast cancer is a heterogeneous disease and is classified into three major subtypes: luminal, human epidermal growth factor receptor 2+ (HER2+), and basal like based on comprehensive gene expression profiling [3]. These subtypes differed from each other as regards risk factors for incidence, response to treatment, disease progression, and preferential organ sites of metastases [4].

The proto-oncogene B-cell lymphoma 6 (BCL6) is a master regulator of B-lymphocyte development and facilitates proliferative expansion and blocks differentiation into plasma and memory cells [5]. B cell activation, tolerance of Deoxy Ribonucleic Acid damage, cell cycle arrest, plasma cell differentiation, Nuclear Factor Kappa B (NF-kB) signaling and apoptosis are a broad spectrum of genes modulated by BCL6 [6].

The transcriptional repressor BCL6 contains a N-terminal (BR-C, TTK and bab) (Pox Virus & Zinc finger) BTB/POZ domain and C-terminal zinc finger DNA-binding motifs and represses transcription of a wide range of target proteins and microRNAs. BCL6 is critical for the development, differentiation or function of several cell types [7].

BCL6 binds to specific DNA sequences in the regulatory region of target genes. Once bound, it recruits co-repressor complexes that introduce repressive chromatin marks, thereby repressing transcription [8]. BCL6 also represses genes involved in terminal differentiation as well as its own expression [9].

Both BCL6 and Signal Transducer and Activator of Transcription (STAT) family of transcription factors have overlapping binding sites including STAT3, also known to have an oncogenic role in breast cancer. Triple-negative breast cancer showed complementary roles of BCL6 and STAT3 [10]. STAT5 over STAT3 mediates prolactin-suppression of the BCL6 oncogene in human breast cancer cell lines [11,12].

The aim of this study was to evaluate the expression of BCL6 mRNA in cancer breast and to determine its correlation with the clinico-pathological features including the molecular subtype of breast carcinoma using real time Polymerase Chain Reaction (PCR).

Materials and Methods

This was a prospective case control study, which was carried out at Pathology and Medical Biochemistry Departments, Faculty of medicine, Menoufia University. This study was performed on 100 cases of modified radical mastectomy specimens diagnosed as an invasive duct carcinoma grade II, not otherwise specified (group I) and 50 cases of breast biopsy diagnosed as benign ones (group II). These cases were received in Pathology Department, Faculty of medicine in the period between January 2014 and August 2015. Fresh part of the tumor mass was collected in eppendorf tube and kept in -80° for further RNA extraction and BCL6 mRNA assay. Slices from the tumor mass were then immersed in formalin and was submitted to routine tissue processing ending with paraffin embedded blocks formation. Tumors were graded according to the criteria of Nottingham modification in the Bloom-Richardson system [13]. Tumour staging was performed according to Tumor Node Metastasis (TNM) staging system [14].

Immunohistochemical (IHC) Staining: The method used for immunostaining was streptavidin-biotin–amplified system. From each block, 4μm thick sections were cut on positive charged slides, which were subjected to subsequent steps of deparaffinization, rehydration and antigen retrieval by boiling in citrate buffer saline (pH 6) followed by cooling at room temperature. The primary antibodies were incubated overnight at room temperature and they included Estrogen Receptor (ER) (clone 1D5; Dilution, 1:50) (DakoCytomation), Progesterone Receptor (PR) (clone IA6; Dilution, 1:50) (DakoCytomation) and HER2/neu (clone 250, Dilution, 1:100) (Dako Cytomation). Breast cancer cases positive for ER, PR, and HER2/neu were used as positive control slides. Negative control slides were also included in each run and prepared by the replacement of primary antibodies by buffer solution. Secondary antibody was applied with diaminobenzidine (DAB) as a chromogen substrate and Mayer’s haematoxylin as a counter stain.

Immunostaining Interpretation: ER and PR were considered positive if ≥1% of tumor cell nuclei are immunoreactive [15]. HER2/neu immunoreactivity was evaluated according to the American Society of Clinical Oncology guideline recommendations [16]. Positive HER2/neu cases were defined as 3 positivity (>10% intense and complete staining); however, score 0 or 1 was considered negative.

According to the IHC results of ER, PR and HER2/neu, the cases were classified into;

-Luminal subtype [Table/Fig-1a,b]: positive ER and/or PR and negative HER 2/neu.

Invasive duct carcinoma luminal type showing moderate to strong nuclear immunoreactivity for ER (a) and PR (b). Her 2 neu positive strong membranous staining (+++) (c) (Immunohistochemical staining & x200).

-HER 2/neu positive subtype [Table/Fig-1c]: negative ER, negative PR and positive HER2/neu.

- Triple negative (TN) subtype: negative ER, negative PR and negative HER 2 neu [17].

Assay of BCL6 mRNA

RNA extraction from breast tissue: Total RNA was extracted from specimens using a commercially available kit (QIAamp RNA Blood MiniKit, Qiagen, USA) according to manufacturer’s instructions [18].

The purity of RNA was determined by measuring its absorbance at 260 nm (A260). Absorbance readings should be greater than 0.15 to ensure significance. The ratio between the absorbance value at 260 and 280 nm (A260 /A280) gives an estimate of RNA purity. (A260/A280) ratio greater than 1.6 was accepted. If the purity was lower than 1.5, it required re-extraction [19].

Two-step RT–PCR was done as follows: For reverse transcription step, samples were prepared in a final volume of 20ul containing RT buffer, 5.5mM MgCl2, 500mM each dNTP, 2.5mM random hexamers, 0.4U/mL RNase inhibitor, 1.25U/mL Multi scribe reverse transcriptase (PE Applied Biosystems), and 20ng total RNA. Then the samples were incubated at 25°C for 10 minutes and at 48°C for 30 minutes. Heating to 95°C for 5 minutes inactivated the reverse transcriptase on 2720 thermal cycler Singapore.

For cDNA amplification the sequence of primers of BCL6, forward CCAGCCACAAGACCGTCCAT and CCAGCCACAAGACCGTCCAT as reverse primer according to Genbank NC_000003 were used with SensiFAST™ SYBR® Lo-ROX Kit, Applied Biosystems, 850 Lincoln Centre Drive, Foster City, California 94404, USA, nuclease free water, cDNA in a total reaction volume 25ul and using GAPDH as endogenous control.

Thermal cycling conditions comprised an initial incubation at 50°C for 2 minutes, AmpliTaq gold activation at 95°C for 10 minutes, 40 cycles of denaturation at 95°C for 15 seconds and annealing and extension at 60°C for 1 minute [20].

For relative quantification of the results obtained by Reverse Transcription Polymerase Chain Reaction RT–PCR, The comparative Cycle Threshold (Ct) method was used. Analysis was performed using Applied Biosystems 7500, software version 2.0.1. The point at which the PCR product is first detected above a fixed threshold— termed Ct — was determined for each sample. Each run was completed using melting curve analysis to confirm specificity of the amplification and absence of primer dimmers [Table/Fig-2].

Amplification plot of BCL6 gene expression.

Statistical Analysis

Results were collected, tabulated, statistically analyzed by IBM personal computer and statistical package SPSS version 16 (SPSS Inc. Chicago, Illinois, USA). All data were expressed as mean±SD, number and percent. A p-value of < 0.05 was considered statistically significant.

Results

Clinico-Pathological Data of Breast Carcinoma Cases: The studied cases were all females. The tumor size ranged between 1 and 5 cm in maximal dimension. According to T stage, 35%, 46%, 14% and 5% belonged to T1, T2, T3 and T4 stages, respectively. Twenty four percent of cases lacked lymph node affection while 76% of cases showed lymph node involvement since N1 comprising 34%, N2 31% and N3 11%. According to molecular subtyping, 40% of cases were luminal, 39% were Her2 positive and 21% belonged to triple negative category. Nearby carcinoma in-situ component was identified in 11% of the cases [Table/Fig-3].

Clinico-pathological data.

Malignant casesControl group
No.%
Age (years)Mean±SD48.7±12.945.2±9.1
Median4845
Range21-8221-59
Tumor size (cm)Mean±SD3.3±1.3
Median3
Range1-5
T stage13535
24646
31414
455
N stage02424
13434
23131
31111
Number of positive lymph nodeMean±SD4.3±3.9
Median4
Range0-17
TypeLuminal4040
Her2 positive3939
Triple Negative2121
Nearby in situ componentNegative8989
Positive1111

Comparison between BCL6 Level in Benign and Malignant Breast Lesions: There was a significant higher Relative Quantition (RQ) of mRNA level of BCL6 in malignant cases (group I) compared to benign cases (group II) (p<0.001) [Table/Fig-4].

Comparison between control and malignant groups regarding RQ of BCL6 mRNA levels.

Control groupMalignant casesTest p-value
RQ of BCL6 mRNAMean±SD6.9±2.428±16.2U= 3.5 p<0.001 HS
Median7.122.5
Range2.5-12.410.9-89.7

The Relationship between BCL6 Level and the Studied Clinico-Pathological Parameters in Breast Carcinoma: High BCL6 mRNA levels were significantly associated with cases showing advanced tumor stage (T3 and T4) (p=0.04), triple negative subtype (p<0.001) and with cases associated with nearby carcinoma in situ component (p<0.001) [Table/Fig-5].

Correlation between RQ of BCL6 mRNA levels and clinicopathological data of malignant cases.

No. of casesBCL6 geneTestp-value
Mean±SDMedianRange
Age100r= 0.010.91
Tumor size100r= 0.150.13
T stageearly (T1 & T2)8126±13.722.112.4-89.7u= 5360.04 S
advanced (T3 & T4)1936.7±22.326.510.9-81.9
N stageearly (N0 & N1)6227.6±17.321.110.9-89.7u=10.23
advanced (N2 & N3)3828.6±14.324.212.4-76.8
Number of positive lymph nodes100r= 0.060.56
TypeLuminal4018.2±3.818.510.9-30.7k= 61.4<0.001 HS
Her2 positive3927.3±10.724.316-71.5
Triple negative2148±20.943.720.5-89.7
Nearby insitu componentnegative8923.5±8.121.410.9-51.3U=16<0.001 HS
positive1165±17.867.530.7-89.7

Discussion

BCL6 has earned a reputation as an oncogene in human cancers by negative regulation of p53 [21,22]. Several lines of evidence suggest that BCL6 may play a role in the pathogenesis of breast cancer. BCL6 has been shown to prevent differentiation of mammary cells [23].

In this study, we observed that BCL6 mRNA was significantly higher in malignant cases compared to control group as noticed by others [24,25]. Walker and his colleges demonstrated that BCL6 is expressed in most breast cancer cells lines and that its genetic locus is amplified in approximately 50% of breast tumor samples and the majority of breast cancer cell lines [26]. Also, BCL6 was upregulated in malignant ovarian epithelial cancer [27].

Through its effects on gene regulation, BCL6 controls cellular processes including cell cycle progression, DNA damage sensing, and protein ubiquitination [28,29]. Moreover, BCL6 is important for breast cancer cell survival [26].

The expression of BCL6 positively associates with the tumor-promoting function of Cyclin D1 Protein (CCND1) and Hypoxia-inducible Factor (HIF1α) in invasive breast cancer [30]. While BCL6 is rarely detected by IHC in normal mammary epithelium, it is commonly expressed in breast cancers, and has been found in 68% of high grade ductal carcinomas [23,30]. In our study, levels of BCL6 mRNA were higher in breast cancer cases presented with advanced T-stage. Pinto and his colleges have similar results but not reach the level of significance [31]. Also, in ovarian carcinoma, the expression levels of BCL6 were upregulated in tumors with advanced International Federation of Gynecology and Obstetrics (FIGO) stage [27].

The correlation between BCL6 upregulation and higher tumour burden in the form of advanced T stage or associated in situ component in our study, suggested that, BCL6 may facilitate tumor progression in breast carcinoma mainly via stimulating tumor growth and tumour invasion, which was supported by the results of in vitro experiments [27,32].

BCL6 was reported to exert a “hit-and-run” mechanism in diffuse Large B Cell Lymphoma (DLBCL), which mean that even transient overexpression of BCL6 can obviously trigger the oncogenicity of DLBCL [33]. Wang and his colleges identified that transient over-expression of BCL6 could significantly upregulate CyclinB1 and CDC25B to accelerate the cell cycle progression, thus promoting the tumour cell proliferation [27].

Triple negative breast cancer, comprise about 20 to 30% of breast tumors and carried poor prognosis and increased mortality due to the lack of specific targeted therapy [34]. In this study, we observed that levels of BCL6 mRNA were significantly higher in triple negative cases compared to luminal and HER2 positive cases. However, in another study, expression levels did not correlate with a specific breast cancer subtype [26].

In spite of BCL6 expression in most breast cancer cell lines, including triple negative breast cancer cell lines [26], triple negative breast cancer cell lines were among the most sensitive to BCL6 inhibition [23]. BCL6 is upregulated by STAT3 [12]. STAT3 activation is restricted largely to triple negative breast cancer cell lines and STAT3 signaling has been shown to be important for the survival of triple negative breast tumors [10]. This may explain the association between BCL6 and triple negative subtype in our study.

Both BCL6 and STAT3 play critical roles, in triple negative breast cancer including promoting survival and epithelial mesenchymal transition(EMT), through modulating largely distinct target genes [34]. Triple negative breast tumors may benefit more strongly from treatment with a BCL6 inhibitor. This may be particularly important as these tumors often become resistant to chemotherapy. Targeting BCL6 with peptidomimetic or small molecule inhibitors kills breast cancer cells alone and in combination with STAT3 or Janus kinase 2 (Jak2) inhibitors [26].

Limitation

The limitation of the present study was the absence of follow up and survival data, which would greatly help in assessing the prognostic value of BCL6

Conclusion

This study concluded that BCL6 over-expression may be used as a biomarker to monitor the invasiveness of tumor and to predict the prognostic risk of patients with cancer breast and the BCL6 inhibitors might be considered as targeted therapy for breast cancer.

References

[1]Jemal A, Siegel R, Xu J, Elizabeth ward (2010): Cancer statistics, 2010 CA Cancer J Clin 2010 60(5):277-300.  [Google Scholar]

[2]Stapleton JM, Mullan PB, Dey S, Hablas A, Gaafar R, Seifeldin IA, Patient-mediated factors predicting early- and late-stage presentation of breast cancer in Egypt Psychooncology 2011 20(5):532-37.  [Google Scholar]

[3]Kornelia P, Heterogeneity in breast cancer J Clin Invest 2011 121(10):3786-88.  [Google Scholar]

[4]Sorlie T, Perou CM, Tibshirani R, Aas T, Geisler S, Johnsen H, Gene expression patterns of breast carcinomas distinguish tumour subclasses with clinical implications Proc Natl Acad Sci USA 2001 98(19):10869-74.  [Google Scholar]

[5]Shaffer AL, Yu X, He Y, Boldrick J, Chan EP, Staudt LM, BCL-6 represses genes that function in lymphocyte differentiation, inflammation, and cell cycle control Immunity 2000 13(2):199-212.  [Google Scholar]

[6]Basso K, Dalla-Favera R, Roles of BCL6 in normal and transformed germinal center B cells Immunol Rev 2012 247(1):172-83.  [Google Scholar]

[7]Sawant DV, Wu H, Kaplan MH, Dent AL, The BCL6 target gene microRNA-21 promotes Th2 differentiation by a T cell intrinsic pathway Mol Immunol 2013 54(3-4):435-42.  [Google Scholar]

[8]Polo JM, Ci W, Licht JD, Melnick A, Reversible disruption of BCL6 repression complexes by CD40 signaling in normal and malignant B cells Blood 2008 112(3):644-51.  [Google Scholar]

[9]Parekh S, Polo JM, Shaknovich R, Juszczynski P, Lev P, Ranuncolo SM, BCL6 programs lymphoma cells for survival and differentiation through distinct biochemical mechanisms Blood 2007 110:2067-74.  [Google Scholar]

[10]Marotta LL, Almendro V, Marusyk A, Shipitsin M, Schemme J, Walker SR, The JAK2/STAT3 signaling pathway is required for growth of CD44+CD24 − stem cell-like breast cancer cells in human tumors J Clin Invest 2011 121(7):2723-35.  [Google Scholar]

[11]Tran TH, Utama FE, Lin J, Yang N, Sjolund AB, Ryder A, Prolactin inhibits BCL6 expression in breast cancer through a Stat5a-dependent mechanism Cancer Res 2010 70(4):1711-21.  [Google Scholar]

[12]Walker SR, Nelson EA, Zou L, Chaudhury M, Signoretti S, Richardson A, Reciprocal effects of STAT5 and STAT3 in breast cancer Mol Cancer Res 2009 7(6):966-76.  [Google Scholar]

[13]Elston CW, Ellis IO, Pathological prognostic factors in breast cancer. I. The value of histological grade in breast cancer: experience from a large study with long-term follow-up Histopathology 1991 19(5):403-10.  [Google Scholar]

[14]Edge SB, Byrd DR, Compton CC, Breast In: AJCC cancer staging manual 2010 7th editionNew York, NYSpringer:347-76.  [Google Scholar]

[15]Hammond ME, Hayes DF, Dowsett M, Allred DC, Hagerty KL, Badve S, American society of clinical oncology/college of american pathologists guideline recommendations for immunohistochemical testing of estrogen and progesterone receptors in breast cancer Arch Pathol Lab Med 2010 134(7):e48-72.  [Google Scholar]

[16]Wolff AC, Hammond ME, Schwartz JN, Hagerty KL, Allred DC, Cote RJ, American society of clinical oncology/college of american pathologists. American society of clinical oncology/college of american pathologists guideline recommendations for human epidermal growth factor receptor 2 testing in breast cancer J Clin Oncol 2007 131(1):18-43.  [Google Scholar]

[17]Goldhirsch A, Wood WC, Coates AS, Gelber RD, Thürlimann B, Senn HJ, Strategies for subtypes–dealing with the diversity of breast cancer: highlights of the St. Gallen international expert consensus on the primary therapy of early breast cancer Ann Oncol 2011 22(8):1736-47.  [Google Scholar]

[18]Wang E, Miller L, Ohnmacht G, Liu E, Marincola F, High-fidelity mRNA amplification for gene profiling Nature Biotechnology 2000 18(4):457-59.  [Google Scholar]

[19]Dorak M, Real-time PCR Clinical Chemistry 2004 50:1680  [Google Scholar]

[20]Lossos IS, Jones CD, Warnke R, Natkunam Y, Kaizer H, Zehnder JL, Expression of a single gene, BCL-6, strongly predicts survival in patients with diffuse large B-cell lymphoma Blood 2001 98(4):945-51.  [Google Scholar]

[21]Basso K, Dalla-Favera R, BCL6: master regulator of the germinal center reaction and key oncogene in B cell lymphomagenesis Adv Immunol 2010 105:193-210.  [Google Scholar]

[22]Ritz O, Rommel K, Dorsch K, Kelsch E, Melzner J, Buck M, STAT6-mediated BCL6 repression in primary mediastinal B-cell lymphoma (PMBL) Oncotarget 2013 4(7):1093-102.  [Google Scholar]

[23]Logarajah S, Hunter P, Kraman M, Steele D, Lakhani S, Bobrow L, BCL-6 is expressed in breast cancer and prevents mammary epithelial differentiation Oncogene 2003 22(36):5572-78.  [Google Scholar]

[24]Chen J, Wang M, Guo M, Xie Y, Cong YS, miR-127 regulates cell proliferation and senescence by targeting BCL6 PLoS One 2013 8(11):e80266  [Google Scholar]

[25]Yu JM, Sun W, Hua F, BCL6 induces EMT by promoting the ZEB1-mediated transcription repression of E-cadherin in breast cancer cells Cancer Lett 2015 365(2):190-200.  [Google Scholar]

[26]Walker SR, Liu S, Xiang M, Nicolais M, Hatzi K, Giannopoulou E, The transcriptional modulator BCL6 as a molecular target for breast cancer therapy Oncogene 2015 34(9):1073-82.  [Google Scholar]

[27]Wang YQ, Xu MD, Weng WW, Wei P, Yang YS, Du X, BCL6 is a negative prognostic factor and exhibits pro-oncogenic activity in ovarian cancer Am J Cancer Res 2014 5(1):255-66.  [Google Scholar]

[28]Polo JM, Juszczynski P, Monti S, Cerchietti L, Ye K, Greally JM, Transcriptional signature with differential expression of BCL6 target genes accurately identifies BCL6-dependent diffuse large B cell lymphomas Proc Natl Acad Sci U S A 2007 104(9):3207-12.  [Google Scholar]

[29]Ci W, Polo JM, Cerchietti L, Shaknovich R, Wang L, Yang SN, The BCL6 transcriptional program features repression of multiple oncogenes in primary B cells and is deregulated in DLBCL Blood 2009 113(22):5536-48.  [Google Scholar]

[30]Bos R, Van Diest PJ, Van der Groep P, Greijer AE, Hermsen MA, Heijnen I, Protein expression of B-cell lymphoma gene 6 (BCL-6) in invasive breast cancer is associated with cyclin D1 and hypoxia-inducible factor-1alpha (HIF-1alpha) Oncogene 2003 22(55):8948-51.  [Google Scholar]

[31]Pinto AE, André S, Silva G, Vieira S, Santos AC, Dias S, BCL-6 oncoprotein in breast cancer: loss of expression in disease progression Pathobiology 2009 76(5):235-42.  [Google Scholar]

[32]Kong FF, Qu ZQ, Yuan HH, Wang JY, Zhao M, Guo YH, Overexpression of FOXM1 is associated with EMT and is a predictor of poor prognosis in non-small cell lung cancer Oncol Rep 2014 31(6):2660-68.  [Google Scholar]

[33]Green M, Campos-Sánchez E, Cobaleda C, Transient expression of Bcl6 is sufficient for oncogenic function and induction of mature B-cell lymphoma Nat Commun 2014 5:3904  [Google Scholar]

[34]Walker SR, Frank DA, Targeting BCL6 and STAT3 in triple negative breast cancer: the one-two punch? Oncoscience 2015 2(11):912  [Google Scholar]