Journal of Clinical and Diagnostic Research, ISSN - 0973 - 709X

Users Online : 78921

AbstractMaterial and MethodsResultsDiscussionAcknowledgementReferencesDOI and Others
Article in PDF How to Cite Citation Manager Readers' Comments (0) Audio Visual Article Statistics Link to PUBMED Print this Article Send to a Friend
Advertisers Access Statistics Resources

Dr Mohan Z Mani

"Thank you very much for having published my article in record time.I would like to compliment you and your entire staff for your promptness, courtesy, and willingness to be customer friendly, which is quite unusual.I was given your reference by a colleague in pathology,and was able to directly phone your editorial office for clarifications.I would particularly like to thank the publication managers and the Assistant Editor who were following up my article. I would also like to thank you for adjusting the money I paid initially into payment for my modified article,and refunding the balance.
I wish all success to your journal and look forward to sending you any suitable similar article in future"



Dr Mohan Z Mani,
Professor & Head,
Department of Dermatolgy,
Believers Church Medical College,
Thiruvalla, Kerala
On Sep 2018




Prof. Somashekhar Nimbalkar

"Over the last few years, we have published our research regularly in Journal of Clinical and Diagnostic Research. Having published in more than 20 high impact journals over the last five years including several high impact ones and reviewing articles for even more journals across my fields of interest, we value our published work in JCDR for their high standards in publishing scientific articles. The ease of submission, the rapid reviews in under a month, the high quality of their reviewers and keen attention to the final process of proofs and publication, ensure that there are no mistakes in the final article. We have been asked clarifications on several occasions and have been happy to provide them and it exemplifies the commitment to quality of the team at JCDR."



Prof. Somashekhar Nimbalkar
Head, Department of Pediatrics, Pramukhswami Medical College, Karamsad
Chairman, Research Group, Charutar Arogya Mandal, Karamsad
National Joint Coordinator - Advanced IAP NNF NRP Program
Ex-Member, Governing Body, National Neonatology Forum, New Delhi
Ex-President - National Neonatology Forum Gujarat State Chapter
Department of Pediatrics, Pramukhswami Medical College, Karamsad, Anand, Gujarat.
On Sep 2018




Dr. Kalyani R

"Journal of Clinical and Diagnostic Research is at present a well-known Indian originated scientific journal which started with a humble beginning. I have been associated with this journal since many years. I appreciate the Editor, Dr. Hemant Jain, for his constant effort in bringing up this journal to the present status right from the scratch. The journal is multidisciplinary. It encourages in publishing the scientific articles from postgraduates and also the beginners who start their career. At the same time the journal also caters for the high quality articles from specialty and super-specialty researchers. Hence it provides a platform for the scientist and researchers to publish. The other aspect of it is, the readers get the information regarding the most recent developments in science which can be used for teaching, research, treating patients and to some extent take preventive measures against certain diseases. The journal is contributing immensely to the society at national and international level."



Dr Kalyani R
Professor and Head
Department of Pathology
Sri Devaraj Urs Medical College
Sri Devaraj Urs Academy of Higher Education and Research , Kolar, Karnataka
On Sep 2018




Dr. Saumya Navit

"As a peer-reviewed journal, the Journal of Clinical and Diagnostic Research provides an opportunity to researchers, scientists and budding professionals to explore the developments in the field of medicine and dentistry and their varied specialities, thus extending our view on biological diversities of living species in relation to medicine.
Knowledge is treasure of a wise man. The free access of this journal provides an immense scope of learning for the both the old and the young in field of medicine and dentistry as well. The multidisciplinary nature of the journal makes it a better platform to absorb all that is being researched and developed. The publication process is systematic and professional. Online submission, publication and peer reviewing makes it a user-friendly journal.
As an experienced dentist and an academician, I proudly recommend this journal to the dental fraternity as a good quality open access platform for rapid communication of their cutting-edge research progress and discovery.
I wish JCDR a great success and I hope that journal will soar higher with the passing time."



Dr Saumya Navit
Professor and Head
Department of Pediatric Dentistry
Saraswati Dental College
Lucknow
On Sep 2018




Dr. Arunava Biswas

"My sincere attachment with JCDR as an author as well as reviewer is a learning experience . Their systematic approach in publication of article in various categories is really praiseworthy.
Their prompt and timely response to review's query and the manner in which they have set the reviewing process helps in extracting the best possible scientific writings for publication.
It's a honour and pride to be a part of the JCDR team. My very best wishes to JCDR and hope it will sparkle up above the sky as a high indexed journal in near future."



Dr. Arunava Biswas
MD, DM (Clinical Pharmacology)
Assistant Professor
Department of Pharmacology
Calcutta National Medical College & Hospital , Kolkata




Dr. C.S. Ramesh Babu
" Journal of Clinical and Diagnostic Research (JCDR) is a multi-specialty medical and dental journal publishing high quality research articles in almost all branches of medicine. The quality of printing of figures and tables is excellent and comparable to any International journal. An added advantage is nominal publication charges and monthly issue of the journal and more chances of an article being accepted for publication. Moreover being a multi-specialty journal an article concerning a particular specialty has a wider reach of readers of other related specialties also. As an author and reviewer for several years I find this Journal most suitable and highly recommend this Journal."
Best regards,
C.S. Ramesh Babu,
Associate Professor of Anatomy,
Muzaffarnagar Medical College,
Muzaffarnagar.
On Aug 2018




Dr. Arundhathi. S
"Journal of Clinical and Diagnostic Research (JCDR) is a reputed peer reviewed journal and is constantly involved in publishing high quality research articles related to medicine. Its been a great pleasure to be associated with this esteemed journal as a reviewer and as an author for a couple of years. The editorial board consists of many dedicated and reputed experts as its members and they are doing an appreciable work in guiding budding researchers. JCDR is doing a commendable job in scientific research by promoting excellent quality research & review articles and case reports & series. The reviewers provide appropriate suggestions that improve the quality of articles. I strongly recommend my fraternity to encourage JCDR by contributing their valuable research work in this widely accepted, user friendly journal. I hope my collaboration with JCDR will continue for a long time".



Dr. Arundhathi. S
MBBS, MD (Pathology),
Sanjay Gandhi institute of trauma and orthopedics,
Bengaluru.
On Aug 2018




Dr. Mamta Gupta,
"It gives me great pleasure to be associated with JCDR, since last 2-3 years. Since then I have authored, co-authored and reviewed about 25 articles in JCDR. I thank JCDR for giving me an opportunity to improve my own skills as an author and a reviewer.
It 's a multispecialty journal, publishing high quality articles. It gives a platform to the authors to publish their research work which can be available for everyone across the globe to read. The best thing about JCDR is that the full articles of all medical specialties are available as pdf/html for reading free of cost or without institutional subscription, which is not there for other journals. For those who have problem in writing manuscript or do statistical work, JCDR comes for their rescue.
The journal has a monthly publication and the articles are published quite fast. In time compared to other journals. The on-line first publication is also a great advantage and facility to review one's own articles before going to print. The response to any query and permission if required, is quite fast; this is quite commendable. I have a very good experience about seeking quick permission for quoting a photograph (Fig.) from a JCDR article for my chapter authored in an E book. I never thought it would be so easy. No hassles.
Reviewing articles is no less a pain staking process and requires in depth perception, knowledge about the topic for review. It requires time and concentration, yet I enjoy doing it. The JCDR website especially for the reviewers is quite user friendly. My suggestions for improving the journal is, more strict review process, so that only high quality articles are published. I find a a good number of articles in Obst. Gynae, hence, a new journal for this specialty titled JCDR-OG can be started. May be a bimonthly or quarterly publication to begin with. Only selected articles should find a place in it.
An yearly reward for the best article authored can also incentivize the authors. Though the process of finding the best article will be not be very easy. I do not know how reviewing process can be improved. If an article is being reviewed by two reviewers, then opinion of one can be communicated to the other or the final opinion of the editor can be communicated to the reviewer if requested for. This will help ones reviewing skills.
My best wishes to Dr. Hemant Jain and all the editorial staff of JCDR for their untiring efforts to bring out this journal. I strongly recommend medical fraternity to publish their valuable research work in this esteemed journal, JCDR".



Dr. Mamta Gupta
Consultant
(Ex HOD Obs &Gynae, Hindu Rao Hospital and associated NDMC Medical College, Delhi)
Aug 2018




Dr. Rajendra Kumar Ghritlaharey

"I wish to thank Dr. Hemant Jain, Editor-in-Chief Journal of Clinical and Diagnostic Research (JCDR), for asking me to write up few words.
Writing is the representation of language in a textual medium i e; into the words and sentences on paper. Quality medical manuscript writing in particular, demands not only a high-quality research, but also requires accurate and concise communication of findings and conclusions, with adherence to particular journal guidelines. In medical field whether working in teaching, private, or in corporate institution, everyone wants to excel in his / her own field and get recognised by making manuscripts publication.


Authors are the souls of any journal, and deserve much respect. To publish a journal manuscripts are needed from authors. Authors have a great responsibility for producing facts of their work in terms of number and results truthfully and an individual honesty is expected from authors in this regards. Both ways its true "No authors-No manuscripts-No journals" and "No journalsNo manuscriptsNo authors". Reviewing a manuscript is also a very responsible and important task of any peer-reviewed journal and to be taken seriously. It needs knowledge on the subject, sincerity, honesty and determination. Although the process of reviewing a manuscript is a time consuming task butit is expected to give one's best remarks within the time frame of the journal.
Salient features of the JCDR: It is a biomedical, multidisciplinary (including all medical and dental specialities), e-journal, with wide scope and extensive author support. At the same time, a free text of manuscript is available in HTML and PDF format. There is fast growing authorship and readership with JCDR as this can be judged by the number of articles published in it i e; in Feb 2007 of its first issue, it contained 5 articles only, and now in its recent volume published in April 2011, it contained 67 manuscripts. This e-journal is fulfilling the commitments and objectives sincerely, (as stated by Editor-in-chief in his preface to first edition) i e; to encourage physicians through the internet, especially from the developing countries who witness a spectrum of disease and acquire a wealth of knowledge to publish their experiences to benefit the medical community in patients care. I also feel that many of us have work of substance, newer ideas, adequate clinical materials but poor in medical writing and hesitation to submit the work and need help. JCDR provides authors help in this regards.
Timely publication of journal: Publication of manuscripts and bringing out the issue in time is one of the positive aspects of JCDR and is possible with strong support team in terms of peer reviewers, proof reading, language check, computer operators, etc. This is one of the great reasons for authors to submit their work with JCDR. Another best part of JCDR is "Online first Publications" facilities available for the authors. This facility not only provides the prompt publications of the manuscripts but at the same time also early availability of the manuscripts for the readers.
Indexation and online availability: Indexation transforms the journal in some sense from its local ownership to the worldwide professional community and to the public.JCDR is indexed with Embase & EMbiology, Google Scholar, Index Copernicus, Chemical Abstracts Service, Journal seek Database, Indian Science Abstracts, to name few of them. Manuscriptspublished in JCDR are available on major search engines ie; google, yahoo, msn.
In the era of fast growing newer technologies, and in computer and internet friendly environment the manuscripts preparation, submission, review, revision, etc and all can be done and checked with a click from all corer of the world, at any time. Of course there is always a scope for improvement in every field and none is perfect. To progress, one needs to identify the areas of one's weakness and to strengthen them.
It is well said that "happy beginning is half done" and it fits perfectly with JCDR. It has grown considerably and I feel it has already grown up from its infancy to adolescence, achieving the status of standard online e-journal form Indian continent since its inception in Feb 2007. This had been made possible due to the efforts and the hard work put in it. The way the JCDR is improving with every new volume, with good quality original manuscripts, makes it a quality journal for readers. I must thank and congratulate Dr Hemant Jain, Editor-in-Chief JCDR and his team for their sincere efforts, dedication, and determination for making JCDR a fast growing journal.
Every one of us: authors, reviewers, editors, and publisher are responsible for enhancing the stature of the journal. I wish for a great success for JCDR."



Thanking you
With sincere regards
Dr. Rajendra Kumar Ghritlaharey, M.S., M. Ch., FAIS
Associate Professor,
Department of Paediatric Surgery, Gandhi Medical College & Associated
Kamla Nehru & Hamidia Hospitals Bhopal, Madhya Pradesh 462 001 (India)
E-mail: drrajendrak1@rediffmail.com
On May 11,2011




Dr. Shankar P.R.

"On looking back through my Gmail archives after being requested by the journal to write a short editorial about my experiences of publishing with the Journal of Clinical and Diagnostic Research (JCDR), I came across an e-mail from Dr. Hemant Jain, Editor, in March 2007, which introduced the new electronic journal. The main features of the journal which were outlined in the e-mail were extensive author support, cash rewards, the peer review process, and other salient features of the journal.
Over a span of over four years, we (I and my colleagues) have published around 25 articles in the journal. In this editorial, I plan to briefly discuss my experiences of publishing with JCDR and the strengths of the journal and to finally address the areas for improvement.
My experiences of publishing with JCDR: Overall, my experiences of publishing withJCDR have been positive. The best point about the journal is that it responds to queries from the author. This may seem to be simple and not too much to ask for, but unfortunately, many journals in the subcontinent and from many developing countries do not respond or they respond with a long delay to the queries from the authors 1. The reasons could be many, including lack of optimal secretarial and other support. Another problem with many journals is the slowness of the review process. Editorial processing and peer review can take anywhere between a year to two years with some journals. Also, some journals do not keep the contributors informed about the progress of the review process. Due to the long review process, the articles can lose their relevance and topicality. A major benefit with JCDR is the timeliness and promptness of its response. In Dr Jain's e-mail which was sent to me in 2007, before the introduction of the Pre-publishing system, he had stated that he had received my submission and that he would get back to me within seven days and he did!
Most of the manuscripts are published within 3 to 4 months of their submission if they are found to be suitable after the review process. JCDR is published bimonthly and the accepted articles were usually published in the next issue. Recently, due to the increased volume of the submissions, the review process has become slower and it ?? Section can take from 4 to 6 months for the articles to be reviewed. The journal has an extensive author support system and it has recently introduced a paid expedited review process. The journal also mentions the average time for processing the manuscript under different submission systems - regular submission and expedited review.
Strengths of the journal: The journal has an online first facility in which the accepted manuscripts may be published on the website before being included in a regular issue of the journal. This cuts down the time between their acceptance and the publication. The journal is indexed in many databases, though not in PubMed. The editorial board should now take steps to index the journal in PubMed. The journal has a system of notifying readers through e-mail when a new issue is released. Also, the articles are available in both the HTML and the PDF formats. I especially like the new and colorful page format of the journal. Also, the access statistics of the articles are available. The prepublication and the manuscript tracking system are also helpful for the authors.
Areas for improvement: In certain cases, I felt that the peer review process of the manuscripts was not up to international standards and that it should be strengthened. Also, the number of manuscripts in an issue is high and it may be difficult for readers to go through all of them. The journal can consider tightening of the peer review process and increasing the quality standards for the acceptance of the manuscripts. I faced occasional problems with the online manuscript submission (Pre-publishing) system, which have to be addressed.
Overall, the publishing process with JCDR has been smooth, quick and relatively hassle free and I can recommend other authors to consider the journal as an outlet for their work."



Dr. P. Ravi Shankar
KIST Medical College, P.O. Box 14142, Kathmandu, Nepal.
E-mail: ravi.dr.shankar@gmail.com
On April 2011
Anuradha

Dear team JCDR, I would like to thank you for the very professional and polite service provided by everyone at JCDR. While i have been in the field of writing and editing for sometime, this has been my first attempt in publishing a scientific paper.Thank you for hand-holding me through the process.


Dr. Anuradha
E-mail: anuradha2nittur@gmail.com
On Jan 2020

Important Notice

Original article / research
Year : 2012 | Month : May | Volume : 6 | Issue : 3 | Page : 400 - 404

Molecular typing of enteropathogenic Escherichia coli from diarrheagenic stool samples

Dhanashree B. , Shrikara P. Mallya,

1. Corresponding Author, 2. Professor, Department of Microbiology, Kasturba Medical College, Mangalore, Manipal University, India.

Correspondence Address :
Dr. Dhanashree B.,
Associate Professor, Department of Microbiology,
Kasturba Medical College, Manipal University,
Mangalore – 575 001
E-mail: dbiranthabail@yahoo.co.in

Abstract

Background: Acute diarrhoea is a leading cause of mortality in the developing countries. Enteropathogenic Escherichia coli (EPEC) were originally serogroup-defined E.coli which were associated with infantile diarrhoea. Hence, only serotyping was used for the discrimination of EPEC. Molecular typing methods, due to their higher discriminating ability, may help in the better characterization of the EPEC isolates and these have been used worldwide. However, the molecular typing of the EPEC strains has not been reported from this part of the country. Hence, this study was undertaken with the following aims and objectives.
Aim and objectives:
This study was aimed at subjecting the EPEC isolates from the stool samples to molecular typing methods like the Random Amplification of Polymorphic DNA (RAPD) and Enterobacterial repetitive intergenic consensus sequences (ERIC) polymerase chain reaction (PCR). The results of these typing methods were compared with those of conventional methods like antibiogram and serotyping to study their similarities and differences.
Materials and Methods:
E.coli strains (n=35), which were isolated over a period of two years from diarrheagenic stool samples (n=100), were subjected to antibiotic susceptibility testing by the disc diffusion method. The EPEC strains which were confirmed by PCR were serotyped at the National Salmonella and Escherichia Centre, Kasauli, India. The EPEC strains were subjected to molecular typing methods like RAPD and ERIC PCR.
Results:
Among the 35 E.coli isolates, 25 belonged to the serogroup O101 and they were positive for the eae gene. Among these, one of the eae positive isolates was also positive for the EHEC hlyA gene; five isolates were of the O111 serotype and they had both the eae and the bfp genes; there were five nontypeable strains which were negative for all the virulence genes which were tested. The non typeable E.coli strains were sensitive to all the antibiotics were tested, except ampicillin. Two EPEC isolates which belonging to the serogroup O111, showed genetic similarity in both RAPD and ERIC PCR.
Conclusion:
EPEC isolates which belonged to same serogroup were found to be highly diverse, as shown by their differing antibiotic susceptibility patterns and by their ERIC PCR and RAPD profiles. The genetic similarities which were observed among few EPEC strains indicated a common ancestral origin or source.

Keywords

Enteropathogenic E.coli, RAPD, ERIC PCR, Molecular typing

Introduction
Diarrheagenic E.coli include enteropathogenic E.coli (EPEC), enterotoxigenic E.coli (ETEC), enteroinvasive E.coli (EIEC), enteroaggregative E.coli (EAEC) and shiga toxin producing E.coli (STEC) (1). EPEC, in addition to their ability to induce attaching and effacing (AE) lesions, also possesses a large EPEC adherence factor (EAF) plasmid and the cluster of genes that encode the bundle-forming pili (BFP) (2),(3). The EPEC strains which carry the eae gene but lack the EAF plasmid and the stx gene are described as atypical EPEC. The atypical EPEC is more closely related to the STEC, which appears to be an emerging pathogen (4). Serotyping alone is insufficient for the strain differentiation of the diarrheagenic E.coli, as it has already been done in many clinical microbiology laboratories. The study of the genetic relatedness by molecular typing methods like RAPD and ERIC PCR has contributed to the assessment of the pathogenic diversity of the E. coli, the relationships between the serotypes and the virulence properties of the strains (5). The molecular typing of the EPEC strains has not been reported so far, from this part of the country. Hence, E.coli isolates from stool samples were studied for their antibiograms and serotypes and they were characterized further by using RAPD and ERIC PCR.

Material and Methods

Bacterial strains:
E.coli strains (n=35) which were isolated over a period of two years from diarrheagenic stool samples (n=100), which were received for routine culture sensitivity testing at the Department of Microbiology, Kasturba Medical College Hospital, Mangalore India, were included in the study, with the approval of the institutional ethics committee.
Isolation of Escherichia coli from the stool samples:
The stool samples were microscopically screened for pus cells, RBCs and the ova and cysts of parasites. The culture media and the antibiotic supplements which were used in the study were procured from Hi-Media Laboratories, Mumbai. All the stool samples with pus cells and RBCs were cultured to isolate E. coli as well as other enteric pathogens (6). Briefly, 4-5 loopfuls of the stool sample were added to 10 ml of modified tryptic soy broth (TSB containing 20 mg/l novobiocin), selenite F broth (SFB) and alkaline peptone water (APW) and these were incubated for 6-8 h at 37°C. Enrichment cultures in modified TSB were streaked onto sorbitol MacConkey’s agar (SMAC) and MacConkey’s agar. The SFB and APW were subcultured onto MacConkey’s agar, deoxycholate citrate agar (DCA) and thiosulphate citrate bile salt sucrose (TCBS) agar and these were examined for the presence of other enteric pathogens like, Salmonella spp., Shigella spp., Vibrio spp. and Aeromonas spp. The plates were incubated for 18-24 h at 37oC. The sorbitol fermenting, sorbitol non-fermenting, lactose fermenting and lactose non-fermenting colonies were picked up and identified biochemically (7).
Detection of the EPEC and the STEC virulence genes by PCR
Extraction of DNA from the E.coli isolates (6):
The biochemically confirmed E.coli isolates were further tested for the presence of the virulence genes of EPEC and STEC like, the eaeA, bfp, stx1, stx2, rfb O157, and the EHEC hlyA genes. The E.coli isolates (3 to 4 colonies) were emulsified in sterile distilled water. Phenol and chloroform were added in a 1:1 ratio. This mixture was vortexed and centrifuged at 5000 g. The aqueous layer was transferred into a fresh tube. The DNA was precipitated with ethanol by keeping at -20°C for 1-2 hour, after which it was centrifuged and the pellet was re-suspended in sterile PCR grade water. It was centrifuged again and the supernatant was used as DNA for all the PCR reactions. The primers which were used for the detection of the EPEC and the STEC virulence genes (8), (9):
stx1:
stx2:
rfb O157:
EHEC hlyA:
eaeA:
and bfp:
The PCR reaction included initial denaturation at 95°C for 5 min, followed by 35 cycles of denaturation at 95°C for 1 min, annealing at 58°C for 1.5 min, extension at 72°C for 1.5 min and a final extension at 72°C for 5 min. The PCR products were separated on a 1.5% agarose gel, stained with ethidium bromide (10) and photographed. The lysates which were positive for only the eae gene and negative for the other STEC genes were further tested for the presence of the bfp gene by PCR, at an annealing temperature of 56oC for 1 min. In all the PCR reactions, the E.coli reference strains, EDL933 and E2348/69 were used as positive controls for STEC and EPEC respectively. The E.coli ATCC 25922 strain was used as a negative control.
A ntibiotic susceptibility testing:
Antibiotic susceptibility testing was performed by the disk diffusion method and it was interpreted as per the Clinical and Laboratory Standards Institute (CLSI) standards (11). Different antibiotic disks like ampicillin, ceftazidime, cephotaxime, ciprofloxacin, ceftriaxone, cefuroxime, chloramphenicol and gentamicin (Hi-Media Laboratories, Mumbai) were used. E.coli ATCC 25922 was used as the quality control strain.
Serotyping of the E.coli isolates:
All the E.coli isolates from the stool samples, which were tested for the virulence genes by PCR, were serotyped at the National Salmonella and Escherichia Centre, Kasauli, India.
Molecular typing by RAPD and ERIC PCR:
Two custom-synthesized, decamer, random primers, R1 (5’GCGATCCCCA3’) and R2 (5’CAGCACCCAC3’), which were procured from Bangalore Genei, Bangalore, were used for the RAPD reaction. The DNA amplification and the detection of the amplified product were done according to the methods of Neilan (12), and Sambrook et al (10). The amplifications were performed in a 25 μl reaction mixture which consisted of genomic DNA, 1× reaction buffer, 100 μM of dNTPs, 0.2 μM of the single random primer, 2.5 μM of MgCl2 and 1U of Taq polymerase. The amplification reaction conditions were: initial delay at 94°C for 5 min, 35 cycles of denaturation at 94°C for 1 min, annealing at 36°C for 1 min, extension at 72°C for 2 min and the final delay at 72°C for 10 min. The amplified product was resolved on a 2% agarose gel, stained with ethidium bromide and photographed.
The custom-synthesized ERIC primers, ER-1 <5’ATGTAAGCTCCTGGGGATTCAC3’> and ER-2 <5’AAGTAAGTGACTGGGGTGAGCG3’> were used for ERICPCR. The DNA amplification and the detection of the amplified product were done according to the methods of Dallacosta et al (13). The PCR amplifications were performed in 25 µl volumes which contained 5 mM of MgCl2, 2 U of Taq polymerase, 0.4 mM (each) of dNTPs, 2 µl of crude template DNA, and 25 pM of the ER-1 or ER-2 primer. The reaction mixture was initially denatured for 2 min at 94°C, subjected to 35 cycles of denaturation at 94°C for 30s, annealed at 60°C for 1 min, extended at 72°C for 4.5 min and finally extended at 72°C for 5 min. The amplified PCR products were resolved by electrophoresis on a 2% agarose gel and photographed (10).

Results

Among the 100 stool samples which were screened, 35 samples showed the growth of E.coli, two samples had Salmonella typhimurium, one had Shigella sonnei and one sample each had Vibrio parahaemolyticus and Aeromonas hydrophila, as shown in (Table/Fig 1). PCR which was performed on the 35 biochemically confirmed E.coli strains for the detection of various STEC and EPEC genes showed 24 strains to be positive for only the eae gene. One was positive for both the eae and the EHEC hlyA genes, five isolates had both the eae and the bfp genes and others (n=5) were negative for all the EPEC and the STEC genes which were tested. The E.coli strains which carried the eae gene, but lacked the bfp and the STEC genes, were considered as atypical EPEC and the E. coli isolates which carried both the eae and the bfp genes were considered as typical EPEC. The E.coli isolates with both the eae and the EHEC hlyA genes were considered as STEC. Twenty four E.coli isolates which were positive for only the eae gene and one isolate that was positive for the eae and the EHEC hlyA genes belonged to the serogroup O101. Five isolates which were positive for both the eae and the bfp genes belonged to the O111 serogroup. Five isolates which were negative for the EPEC and the STEC genes were serologically untypeable. The antibiotic susceptibility pattern of the 35 E.coli isolates is shown in (Table/Fig 2). The thirty five strains of the E.coli isolates which belonged to the different O serogroups were typed by RAPD by using the R1 and R2 primers, which generated 28 and 29 profiles respectively (Table/Fig 3) and (Table/Fig 4). With the R1 primer, the atypical EPEC which belonged to O101 (lanes 15, 16 and 17) and the typical EPEC (eae and bfp positive) strains of the serogroup O111 (lanes 27 and 28) showed genetic similarities among themselves. With the same primer, two typical EPEC strains of O111 also showed similarities with 3 untypeable strains of E.coli [lanes 29 to 33 in (Table/Fig 3). With the R2 primer, five atypical EPEC strains (lanes 15 to 17; lanes 23 and 24), two typical E.coli strains (lanes 27 and 28) and two untypeable E.coli (lanes 32 and 33) showed similarities among themselves (Table/Fig 4). The thirty five strains of the E.coli isolates which belonged to the different O serogroups, which were typed by the ERIC primers, ER-1 and ER-2 generated 28 (Table/Fig 5) and 25 (Table/Fig 6) profiles respectively. Two strains which belonging to O101 (Table/Fig 5) lanes 13 and 14; lanes 15 and 17] showed similarities among themselves. Two typical E.coli strains of O111 showed similarities in their banding pattern [lane 27 and 28 in (Table/Fig 5) and (Table/Fig 6) with both the ERIC primers.

Discussion

The epidemiological significance of each E.coli category may vary with the geographical area. In the present study, the E.coli isolates which were positive for the eae genes alone predominated (24 out of 35). Earlier studies referred to the EPEC strains which carried the eae gene, but lacked the bfp and the STEC genes, as atypical EPEC and the E. coli isolates which carried both the eae and the bfp genes as typical EPEC (3),(4). Even in the present study, the E.coli isolates which were positive for only the eae genes and negative for other genes could be considered as atypical EPEC. This study also showed that atypical EPEC was more commonly isolated than typical EPEC and the same was found to be true in a recently published Indian study from Kolkata (14). However, these eae positive, atypical E.coli require further studies with regards to their virulence and epidemiological significance. Among the 25 eae positive E.coli, one isolate was also positive for the EHEC hlyA gene (virulence gene specific for EHEC) and it belonged to the serogroup O101. Hence, this isolate was considered as STEC other than E.coli O157. The detection of EPEC by serological screening for certain E.coli O-serogroups is still the method of choice in most of the clinical diagnostic laboratories worldwide. The diversity of the serotypes which was found in the EPEC group discouraged the use of serodiagnostic methods for their detection (15),(16). Even in the present study, it was found that the E.coli isolates which belonged to the O101 serotypes (n=25) included one strain of STEC and 24 strains of atypical EPEC. If the detection of the virulence genes was not done, this STEC isolate would have been missed. The therapeutic options vary depending on the type of the E.coli infection. Many investigators have documented a high prevalence of antimicrobial resistance among the EPEC strains in different parts of the world (17). In the present study, the resistance was seen more commonly in the typical EPEC which belonged to the serogroup O111 than in the atypical EPEC strains, which was in agreement with the findings of earlier studies. The untypeable E.coli strains were resistant to only ampicillin. The increasing antimicrobial resistant phenotypes which were seen in the human isolates could be due to the indiscriminate use of antimicrobials in the clinical practice. It was interesting to note that the typical EPEC O111 strains [lanes 27 and 28 in (Table/Fig 3) and (Table/Fig 4) showed genetic similarities among themselves with both the R1and the R2 primers. Earlier studies had used RAPD and multilocus enzyme electrophoresis to show the existence of the two evolutionary divergent groups in EPEC: one was genetically and serologically very homogeneous, while the other harboured the EPEC and the non-EPEC serotypes (18). A similar result was observed in the present study, wherein, molecular typing could show the differences in banding patterns among the isolates which belonged to the same serogroup (Table/Fig 3) and (Table/Fig 4) and the similarity among the isolates which belonged to the same serogroup [lanes 27 and 28 in (Table/Fig 3) and (Table/Fig 4). The ERIC sequences were found to be useful targets for molecular typing (13). The different profiles which were observed in the present study appeared to be due to the differences in the ERIC sequences and due to the differences in the inter-ERIC distances. Earlier studies had indicated the similarity of the strains of E.coli which were isolated from the soil and vegetables which were irrigated by treated wastewater, by using ERIC PCR (13),(19). Two typical EPEC which belonged to the serogroup O111 which showed a similarity in their banding patterns [lanes 27 and 28 in Table/Fig 5 and 6] with both the ERIC primers also showed a similarity in RAPD with both the R1 and the R2 primers [lanes 27 and 28 in (Table/Fig 3) and (Table/Fig 4). Hence, this study indicated that RAPD and ERIC PCR may be used as tools for the differentiation of the E.coli isolates which belonged to the same and different serogroups. The diarrheagenic E.coli strains are not routinely sought as stool pathogens in many clinical laboratories. This study highlights the importance of the routine identification and the characterization of all the E.coli which were isolated from diarrheagenic stool samples. Molecular typing revealed that the typical and atypical EPEC which belonged to the different O serogroups corresponded to the different genetic clusters. The genetic similarities which were observed among the two typical EPEC strains in both RAPD and ERIC PCR indicated a common genetic origin or a common source. Further characterization is needed to prove the pathogenic potential of the untypeable E.coli strains (negative for virulence genes) which were isolated from the stool samples in the present study. To the best of our knowledge, molecular typing has not been used in this part of the country to discriminate E.coli isolates from stool samples. However, an attempt was made in the present study, to study the genetic similarities and the differences among the various serogroups of the E.coli isolates from stool samples. Further studies which involve more number of samples and better discriminating molecular techniques are necessary to know the genetic similarities and the differences among the different diarrheagenic E.coli and commensal E.coli.

Acknowledgement

The authors acknowledge the National Salmonella and Escherichia Centre, Central Research Institute, Kasauli, India for serogrouping the Escherichia isolates and the Indian Council of Medical Research (ICMR), New Delhi for the support.

References

1.
Nataro, Kaper JB. Diarrhoeagenic Escherichia coli. Clin Microbiol Rev 1998;11:142-201.
2.
Clarke SC, Haigh RD, Freestone PE, Williams PH. Virulence of enteropathogenic Escherichia coli, a global pathogen. Clin Microbiol Rev 2003;16:365-78.
3.
Nunes BE, Saridakis OH, Irino K. Genotypic and phenotypic characterization of attaching and effacing Escherichia coli (AEEC) which were isolated from children with and without diarrhoea Londrina, Brazil. J Med Microbiol 2003;52:499-504.
4.
Trabulsi LR, Keller R, Gomesn TA. Typical and atypical enteropathogenic Escherichia coli. Emerg Infect Dis 2002;8:508-13.
5.
Woods CR, Versalovic J, Koeuth T, Lupski JR. Whole cell, repetitive element, sequence-based polymerase chain-reaction allows the rapid assessment of the clonal relationships of bacterial isolates. J Clin Microbiol 1993;31:1927-31.
6.
Dhanashree B, Mallya PS. Detection of the shiga toxigenic Escherichia coli (STEC) in diarrhoeagenic stool and meat samples in Mangalore, India. Indian J Med Res 2008;128:271-77.
7.
Collee JG, Miles RS, Watt B. Tests for the identification of bacteria. In: Collee JG, Fraser AG, Marmion BP, Simmons A (editors). Mackie and Mc Cartney Practical Medical Microbiology, 14th ed. London: Churchill Livingstone, 1996; 131-49.
8.
Paton AW, Paton JC. Detection and characterization of the shiga toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohaemorrhagic E.coli hlyA, rfb 0111 and rfb 0157. J Clin Microbiol 1998;36: 598-602.
9.
Yatsuyanagi J, Saito S, Miyajima Y, Amano K, Enomoto K. Characterization of the typical enteropathogenic Escherichia coli strains which harbor the astA genes which are associated with a waterborne outbreak of diarrhoea in Japan. J Clin Microbiol 2003;41:2033-39.
10.
Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: A Laboratory manual. New York: Cold Spring Harbor Laboratory Press, 1989.
11.
Clinical and Laboratory Standards Institute (CSLI). Performance standards for antimicrobial disk susceptibility testing. 8th ed. CLSI Approved Standard M02-A8 Wayne, Pa. 2005.
12.
Neilan BA. The identification and phylogenetic analysis of toxigenic cynobacteria by multiples randomly amplified polymorphic DNA PCR. Appl Environ Microbiol 1995;61:2286-91.
13.
Dalla-costa LM, Irino K, Rodrigues J, Rivera ING, Trabulsi LR. Characterization of the diarrhoeagenic Escherichia coli clones by ribotyping and ERIC PCR. J Med Microbiol 1998;47:227-34.
14.
Nair GB, Ramamurthy T, Bhattacharya MK, Krishnan T, Ganguly S, Saha DR, et al. Emerging trends in the etiology of enteric pathogens as was evidenced from an active surveillance of hospitalized diarrhoeal patients in Kolkata, India. Gut Pathogens 2010;2:2-13.
15.
Blanco M, Blanco J, Dahbi G, Alonso M.P, Mora A, Coira MA, et al. Identification of two new intimin types among the atypical enteropathogenic Escherichia coli. Int Microbiol 2006;9:103-10.
16.
Kozub-Witkowski E, Krause G, Frankel G, Kramer D, Appel B, Beutin L. Serotypes and virutypes of enteropathogenic and enterohaemorrhagic Escherichia coli strains from the stool samples of children with diarrhoea in Germany. J Applied Microbiol 2008;104:403-10.
17.
Scaletsky ICA, Souza TB, Aranda KRS, Okeke IN. Genetic elements which are associated with anti-microbial resistance in enteropathogenic Escherichia coli (EPEC) from Brazil. BMC Microbiology 2010;10:2-5.
18.
Bando YS, Trabulsi LR, Moreira-Filho CA. Genetic relationship of the diarrheagenic Escherichia coli pathotypes among the enteropathogenic Escherichia coli of the O serogroup. Mem Inst Oswaldo Cruz, Rio de Janeiro 2007;102:169-74.
19.
Ibenyassine K, AitMhand R, Karamoko Y, Cohen N, Ennaji MM. Use of repetitive DNA sequences to determine the persistence of enteropathogenic Escherichia coli in vegetables which were grown in fields which were treated with contaminated irrigation water and in soil. Lett Appl Microbiol 2006;43:528-33.

DOI and Others

DECLARATION ON COMPETING INTERESTS:
No competing Interests.
Date of Submission: Jan 26, 2012
Date of Peer Review: Jan 28, 2012
Date of Acceptance: Jan 30, 2012
Date of Publishing: Undecided

JCDR is now Monthly and more widely Indexed .
  • Emerging Sources Citation Index (Web of Science, thomsonreuters)
  • Index Copernicus ICV 2017: 134.54
  • Academic Search Complete Database
  • Directory of Open Access Journals (DOAJ)
  • Embase
  • EBSCOhost
  • Google Scholar
  • HINARI Access to Research in Health Programme
  • Indian Science Abstracts (ISA)
  • Journal seek Database
  • Google
  • Popline (reproductive health literature)
  • www.omnimedicalsearch.com