Journal of Clinical and Diagnostic Research, ISSN - 0973 - 709X

Users Online : 14180

AbstractMaterial and MethodsResultsDiscussionConclusionReferencesDOI and Others
Article in PDF How to Cite Citation Manager Readers' Comments (0) Audio Visual Article Statistics Link to PUBMED Print this Article Send to a Friend
Advertisers Access Statistics Resources

Dr Mohan Z Mani

"Thank you very much for having published my article in record time.I would like to compliment you and your entire staff for your promptness, courtesy, and willingness to be customer friendly, which is quite unusual.I was given your reference by a colleague in pathology,and was able to directly phone your editorial office for clarifications.I would particularly like to thank the publication managers and the Assistant Editor who were following up my article. I would also like to thank you for adjusting the money I paid initially into payment for my modified article,and refunding the balance.
I wish all success to your journal and look forward to sending you any suitable similar article in future"



Dr Mohan Z Mani,
Professor & Head,
Department of Dermatolgy,
Believers Church Medical College,
Thiruvalla, Kerala
On Sep 2018




Prof. Somashekhar Nimbalkar

"Over the last few years, we have published our research regularly in Journal of Clinical and Diagnostic Research. Having published in more than 20 high impact journals over the last five years including several high impact ones and reviewing articles for even more journals across my fields of interest, we value our published work in JCDR for their high standards in publishing scientific articles. The ease of submission, the rapid reviews in under a month, the high quality of their reviewers and keen attention to the final process of proofs and publication, ensure that there are no mistakes in the final article. We have been asked clarifications on several occasions and have been happy to provide them and it exemplifies the commitment to quality of the team at JCDR."



Prof. Somashekhar Nimbalkar
Head, Department of Pediatrics, Pramukhswami Medical College, Karamsad
Chairman, Research Group, Charutar Arogya Mandal, Karamsad
National Joint Coordinator - Advanced IAP NNF NRP Program
Ex-Member, Governing Body, National Neonatology Forum, New Delhi
Ex-President - National Neonatology Forum Gujarat State Chapter
Department of Pediatrics, Pramukhswami Medical College, Karamsad, Anand, Gujarat.
On Sep 2018




Dr. Kalyani R

"Journal of Clinical and Diagnostic Research is at present a well-known Indian originated scientific journal which started with a humble beginning. I have been associated with this journal since many years. I appreciate the Editor, Dr. Hemant Jain, for his constant effort in bringing up this journal to the present status right from the scratch. The journal is multidisciplinary. It encourages in publishing the scientific articles from postgraduates and also the beginners who start their career. At the same time the journal also caters for the high quality articles from specialty and super-specialty researchers. Hence it provides a platform for the scientist and researchers to publish. The other aspect of it is, the readers get the information regarding the most recent developments in science which can be used for teaching, research, treating patients and to some extent take preventive measures against certain diseases. The journal is contributing immensely to the society at national and international level."



Dr Kalyani R
Professor and Head
Department of Pathology
Sri Devaraj Urs Medical College
Sri Devaraj Urs Academy of Higher Education and Research , Kolar, Karnataka
On Sep 2018




Dr. Saumya Navit

"As a peer-reviewed journal, the Journal of Clinical and Diagnostic Research provides an opportunity to researchers, scientists and budding professionals to explore the developments in the field of medicine and dentistry and their varied specialities, thus extending our view on biological diversities of living species in relation to medicine.
‘Knowledge is treasure of a wise man.’ The free access of this journal provides an immense scope of learning for the both the old and the young in field of medicine and dentistry as well. The multidisciplinary nature of the journal makes it a better platform to absorb all that is being researched and developed. The publication process is systematic and professional. Online submission, publication and peer reviewing makes it a user-friendly journal.
As an experienced dentist and an academician, I proudly recommend this journal to the dental fraternity as a good quality open access platform for rapid communication of their cutting-edge research progress and discovery.
I wish JCDR a great success and I hope that journal will soar higher with the passing time."



Dr Saumya Navit
Professor and Head
Department of Pediatric Dentistry
Saraswati Dental College
Lucknow
On Sep 2018




Dr. Arunava Biswas

"My sincere attachment with JCDR as an author as well as reviewer is a learning experience . Their systematic approach in publication of article in various categories is really praiseworthy.
Their prompt and timely response to review's query and the manner in which they have set the reviewing process helps in extracting the best possible scientific writings for publication.
It's a honour and pride to be a part of the JCDR team. My very best wishes to JCDR and hope it will sparkle up above the sky as a high indexed journal in near future."



Dr. Arunava Biswas
MD, DM (Clinical Pharmacology)
Assistant Professor
Department of Pharmacology
Calcutta National Medical College & Hospital , Kolkata




Dr. C.S. Ramesh Babu
" Journal of Clinical and Diagnostic Research (JCDR) is a multi-specialty medical and dental journal publishing high quality research articles in almost all branches of medicine. The quality of printing of figures and tables is excellent and comparable to any International journal. An added advantage is nominal publication charges and monthly issue of the journal and more chances of an article being accepted for publication. Moreover being a multi-specialty journal an article concerning a particular specialty has a wider reach of readers of other related specialties also. As an author and reviewer for several years I find this Journal most suitable and highly recommend this Journal."
Best regards,
C.S. Ramesh Babu,
Associate Professor of Anatomy,
Muzaffarnagar Medical College,
Muzaffarnagar.
On Aug 2018




Dr. Arundhathi. S
"Journal of Clinical and Diagnostic Research (JCDR) is a reputed peer reviewed journal and is constantly involved in publishing high quality research articles related to medicine. Its been a great pleasure to be associated with this esteemed journal as a reviewer and as an author for a couple of years. The editorial board consists of many dedicated and reputed experts as its members and they are doing an appreciable work in guiding budding researchers. JCDR is doing a commendable job in scientific research by promoting excellent quality research & review articles and case reports & series. The reviewers provide appropriate suggestions that improve the quality of articles. I strongly recommend my fraternity to encourage JCDR by contributing their valuable research work in this widely accepted, user friendly journal. I hope my collaboration with JCDR will continue for a long time".



Dr. Arundhathi. S
MBBS, MD (Pathology),
Sanjay Gandhi institute of trauma and orthopedics,
Bengaluru.
On Aug 2018




Dr. Mamta Gupta,
"It gives me great pleasure to be associated with JCDR, since last 2-3 years. Since then I have authored, co-authored and reviewed about 25 articles in JCDR. I thank JCDR for giving me an opportunity to improve my own skills as an author and a reviewer.
It 's a multispecialty journal, publishing high quality articles. It gives a platform to the authors to publish their research work which can be available for everyone across the globe to read. The best thing about JCDR is that the full articles of all medical specialties are available as pdf/html for reading free of cost or without institutional subscription, which is not there for other journals. For those who have problem in writing manuscript or do statistical work, JCDR comes for their rescue.
The journal has a monthly publication and the articles are published quite fast. In time compared to other journals. The on-line first publication is also a great advantage and facility to review one's own articles before going to print. The response to any query and permission if required, is quite fast; this is quite commendable. I have a very good experience about seeking quick permission for quoting a photograph (Fig.) from a JCDR article for my chapter authored in an E book. I never thought it would be so easy. No hassles.
Reviewing articles is no less a pain staking process and requires in depth perception, knowledge about the topic for review. It requires time and concentration, yet I enjoy doing it. The JCDR website especially for the reviewers is quite user friendly. My suggestions for improving the journal is, more strict review process, so that only high quality articles are published. I find a a good number of articles in Obst. Gynae, hence, a new journal for this specialty titled JCDR-OG can be started. May be a bimonthly or quarterly publication to begin with. Only selected articles should find a place in it.
An yearly reward for the best article authored can also incentivize the authors. Though the process of finding the best article will be not be very easy. I do not know how reviewing process can be improved. If an article is being reviewed by two reviewers, then opinion of one can be communicated to the other or the final opinion of the editor can be communicated to the reviewer if requested for. This will help one’s reviewing skills.
My best wishes to Dr. Hemant Jain and all the editorial staff of JCDR for their untiring efforts to bring out this journal. I strongly recommend medical fraternity to publish their valuable research work in this esteemed journal, JCDR".



Dr. Mamta Gupta
Consultant
(Ex HOD Obs &Gynae, Hindu Rao Hospital and associated NDMC Medical College, Delhi)
Aug 2018




Dr. Rajendra Kumar Ghritlaharey

"I wish to thank Dr. Hemant Jain, Editor-in-Chief Journal of Clinical and Diagnostic Research (JCDR), for asking me to write up few words.
Writing is the representation of language in a textual medium i e; into the words and sentences on paper. Quality medical manuscript writing in particular, demands not only a high-quality research, but also requires accurate and concise communication of findings and conclusions, with adherence to particular journal guidelines. In medical field whether working in teaching, private, or in corporate institution, everyone wants to excel in his / her own field and get recognised by making manuscripts publication.


Authors are the souls of any journal, and deserve much respect. To publish a journal manuscripts are needed from authors. Authors have a great responsibility for producing facts of their work in terms of number and results truthfully and an individual honesty is expected from authors in this regards. Both ways its true "No authors-No manuscripts-No journals" and "No journals–No manuscripts–No authors". Reviewing a manuscript is also a very responsible and important task of any peer-reviewed journal and to be taken seriously. It needs knowledge on the subject, sincerity, honesty and determination. Although the process of reviewing a manuscript is a time consuming task butit is expected to give one's best remarks within the time frame of the journal.
Salient features of the JCDR: It is a biomedical, multidisciplinary (including all medical and dental specialities), e-journal, with wide scope and extensive author support. At the same time, a free text of manuscript is available in HTML and PDF format. There is fast growing authorship and readership with JCDR as this can be judged by the number of articles published in it i e; in Feb 2007 of its first issue, it contained 5 articles only, and now in its recent volume published in April 2011, it contained 67 manuscripts. This e-journal is fulfilling the commitments and objectives sincerely, (as stated by Editor-in-chief in his preface to first edition) i e; to encourage physicians through the internet, especially from the developing countries who witness a spectrum of disease and acquire a wealth of knowledge to publish their experiences to benefit the medical community in patients care. I also feel that many of us have work of substance, newer ideas, adequate clinical materials but poor in medical writing and hesitation to submit the work and need help. JCDR provides authors help in this regards.
Timely publication of journal: Publication of manuscripts and bringing out the issue in time is one of the positive aspects of JCDR and is possible with strong support team in terms of peer reviewers, proof reading, language check, computer operators, etc. This is one of the great reasons for authors to submit their work with JCDR. Another best part of JCDR is "Online first Publications" facilities available for the authors. This facility not only provides the prompt publications of the manuscripts but at the same time also early availability of the manuscripts for the readers.
Indexation and online availability: Indexation transforms the journal in some sense from its local ownership to the worldwide professional community and to the public.JCDR is indexed with Embase & EMbiology, Google Scholar, Index Copernicus, Chemical Abstracts Service, Journal seek Database, Indian Science Abstracts, to name few of them. Manuscriptspublished in JCDR are available on major search engines ie; google, yahoo, msn.
In the era of fast growing newer technologies, and in computer and internet friendly environment the manuscripts preparation, submission, review, revision, etc and all can be done and checked with a click from all corer of the world, at any time. Of course there is always a scope for improvement in every field and none is perfect. To progress, one needs to identify the areas of one's weakness and to strengthen them.
It is well said that "happy beginning is half done" and it fits perfectly with JCDR. It has grown considerably and I feel it has already grown up from its infancy to adolescence, achieving the status of standard online e-journal form Indian continent since its inception in Feb 2007. This had been made possible due to the efforts and the hard work put in it. The way the JCDR is improving with every new volume, with good quality original manuscripts, makes it a quality journal for readers. I must thank and congratulate Dr Hemant Jain, Editor-in-Chief JCDR and his team for their sincere efforts, dedication, and determination for making JCDR a fast growing journal.
Every one of us: authors, reviewers, editors, and publisher are responsible for enhancing the stature of the journal. I wish for a great success for JCDR."



Thanking you
With sincere regards
Dr. Rajendra Kumar Ghritlaharey, M.S., M. Ch., FAIS
Associate Professor,
Department of Paediatric Surgery, Gandhi Medical College & Associated
Kamla Nehru & Hamidia Hospitals Bhopal, Madhya Pradesh 462 001 (India)
E-mail: drrajendrak1@rediffmail.com
On May 11,2011




Dr. Shankar P.R.

"On looking back through my Gmail archives after being requested by the journal to write a short editorial about my experiences of publishing with the Journal of Clinical and Diagnostic Research (JCDR), I came across an e-mail from Dr. Hemant Jain, Editor, in March 2007, which introduced the new electronic journal. The main features of the journal which were outlined in the e-mail were extensive author support, cash rewards, the peer review process, and other salient features of the journal.
Over a span of over four years, we (I and my colleagues) have published around 25 articles in the journal. In this editorial, I plan to briefly discuss my experiences of publishing with JCDR and the strengths of the journal and to finally address the areas for improvement.
My experiences of publishing with JCDR: Overall, my experiences of publishing withJCDR have been positive. The best point about the journal is that it responds to queries from the author. This may seem to be simple and not too much to ask for, but unfortunately, many journals in the subcontinent and from many developing countries do not respond or they respond with a long delay to the queries from the authors 1. The reasons could be many, including lack of optimal secretarial and other support. Another problem with many journals is the slowness of the review process. Editorial processing and peer review can take anywhere between a year to two years with some journals. Also, some journals do not keep the contributors informed about the progress of the review process. Due to the long review process, the articles can lose their relevance and topicality. A major benefit with JCDR is the timeliness and promptness of its response. In Dr Jain's e-mail which was sent to me in 2007, before the introduction of the Pre-publishing system, he had stated that he had received my submission and that he would get back to me within seven days and he did!
Most of the manuscripts are published within 3 to 4 months of their submission if they are found to be suitable after the review process. JCDR is published bimonthly and the accepted articles were usually published in the next issue. Recently, due to the increased volume of the submissions, the review process has become slower and it ?? Section can take from 4 to 6 months for the articles to be reviewed. The journal has an extensive author support system and it has recently introduced a paid expedited review process. The journal also mentions the average time for processing the manuscript under different submission systems - regular submission and expedited review.
Strengths of the journal: The journal has an online first facility in which the accepted manuscripts may be published on the website before being included in a regular issue of the journal. This cuts down the time between their acceptance and the publication. The journal is indexed in many databases, though not in PubMed. The editorial board should now take steps to index the journal in PubMed. The journal has a system of notifying readers through e-mail when a new issue is released. Also, the articles are available in both the HTML and the PDF formats. I especially like the new and colorful page format of the journal. Also, the access statistics of the articles are available. The prepublication and the manuscript tracking system are also helpful for the authors.
Areas for improvement: In certain cases, I felt that the peer review process of the manuscripts was not up to international standards and that it should be strengthened. Also, the number of manuscripts in an issue is high and it may be difficult for readers to go through all of them. The journal can consider tightening of the peer review process and increasing the quality standards for the acceptance of the manuscripts. I faced occasional problems with the online manuscript submission (Pre-publishing) system, which have to be addressed.
Overall, the publishing process with JCDR has been smooth, quick and relatively hassle free and I can recommend other authors to consider the journal as an outlet for their work."



Dr. P. Ravi Shankar
KIST Medical College, P.O. Box 14142, Kathmandu, Nepal.
E-mail: ravi.dr.shankar@gmail.com
On April 2011
Anuradha

Dear team JCDR, I would like to thank you for the very professional and polite service provided by everyone at JCDR. While i have been in the field of writing and editing for sometime, this has been my first attempt in publishing a scientific paper.Thank you for hand-holding me through the process.


Dr. Anuradha
E-mail: anuradha2nittur@gmail.com
On Jan 2020

Important Notice

Original article / research
Year : 2022 | Month : November | Volume : 16 | Issue : 11 | Page : DC01 - DC07 Full Version

Molecular Typing of Methicillin Resistant Staphylococcus aureus using Coa Gene Polymerase Chain Reaction-Restriction Fragment Length Polymorphism: A Cross-sectional Study


Published: November 1, 2022 | DOI: https://doi.org/10.7860/JCDR/2022/57412.17021
P Hema, B Appalaraju, R Someshwaran

1. Tutor, Department of Microbiology, PSG Institute of Medical Sciences and Research, Coimbatore, Tamil Nadu, India. 2. Professor and Head, Department of Microbiology, PSG Institute of Medical Sciences and Research, Coimbatore, Tamil Nadu, India. 3. Associate Professor, Department of Microbiology, PSG Institute of Medical Sciences and Research, Coimbatore, Tamil Nadu, India.

Correspondence Address :
Dr. B Appalaraju,
Professor and Head, Department of Microbiology, PSG Institute of Medical Sciences
and Research, Coimbatore, Tamil Nadu, India.
E-mail: raju_boppe@yahoo.co.in

Abstract

Introduction: Methicillin Resistant Staphylococcus aureus (MRSA) are the most important multidrug resistant pathogen of humans causing a wide array of infections. Polymorphic Coagulase gene (coa) could be targeted for specific typing of Staphylococcus aureus isolates. ‘Possible source’ can be identified and discriminated rapidly for control and prevention of Staphylococcus aureus infections especially in case of suspected outbreaks. Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) have high discriminatory power and enhanced reproducibility. Mutation and variation in number of short sequence repeats lead to distinct amplification of this region of coa gene by PCR. Deoxyribonucleic Acid (DNA) fragments of different sizes obtained by digestion with specific restriction enzymes like Arthrobacter luteus I (AluI) help to discriminate various types based on the patterns produced as a result of PCR-RFLP.

Aim: To determine molecular typing of MRSA by coa gene PCR-RFLP.

Materials and Methods: A cross-sectional study was done in the Department of Microbiology involving 150 clinical isolates of Staphylococcus aureus obtained from various clinical specimens. Genotypic identification of MRSA was done by detecting coa gene and mecA gene by PCR. Molecular typing of MRSA was done by coa gene PCR-RFLP.

Results: Coa gene PCR identified six Genotypic codes (Code I to Code VI) ranging from 300 bp-800 bp size. Restriction digestion of the amplicons of the coa gene by PCR-RFLP using the enzyme AluI provided 17 unique restriction patterns among MRSA isolates in toto. The predominant coa gene PCR Genotype code was “Type IV” which was 600 bp size and predominant RFLP fragment for Genotype code “Type IV” was RFLP Pattern ‘b’ (500 bp, 240 bp and 140 bp fragments) among the study population.

Conclusion: Genotype code ‘IV’ and RFLP pattern ‘b’ was found to be predominant coa gene type among MRSA in this study.

Keywords

mecA, Outbreak, Panton-valentine leukocidin, Typing

Bacterial taxonomy plays a major role in epidemiology, prevention, and effective management of infectious diseases. Recently, both phenotypic and genotypic methods were employed using a polyphasic taxonomic approach to define and identify specific genera, species and subspecies of taxonomical relevance and importance, based on inherently polymorphic loci present in the genomes of all bacterial species by using data sets generated by such methods (1),(2),(3). Primary structure and number of copies per chromosome of conserved and variable nucleotide sequence motifs could be established by direct or indirect DNA typing methods (2), culminating in subspecies level identification. Pulsed field Gel Electrophoresis (PFGE) is considered as the gold standard for molecular typing of MRSA detection and characterisation (4).

The MRSA is a widespread commensal and opportunistic pathogen causing infections both in the community and hospital set-up. Approximately 30% of human populations are nasal carriers of Staphylococcus aureus (5). Increasing incidence of hospital acquired and community acquired MRSA and its carrier state among healthcare workers pose difficulty in treatment and result in poor clinical outcome. MRSA is detected by identification of mecA gene by PCR. This method is considered to be the gold standard when compared to other phenotypic methods (cefoxitin susceptibility test, oxacillin disc diffusion test, oxacillin screening agar, CHROMagar, and latex agglutination test) (3),(5).

‘Possible source’ could be rapidly and rightly identified and discriminated for enhanced control and prevention of Staphylococcus aureus infections, especially in case of suspected outbreaks in hospital environment by various molecular typing methods like PCR based molecular techniques, and typing methods like PFGE and Multilocus Sequence Typing (MLST) (6),(7). These methods are not widely available, time consuming, costly and not feasible despite its discriminatory power to detect the potential pathogens like Staphylococcus aureus (8).

The PCR-RFLP and Random Amplified Polymorphic DNA (RAPD)-PCR have high discriminatory power and enhanced reproducibility compared to the above-mentioned methods and is suitable for all molecular biology laboratories worldwide because of its ease and the reduced cost (9),(10). Plasma coagulation is the result of coagulase, an extracellular virulence factor, that is produced by pathogenic staphylococci. Coagulase not only acts as a cofactor but also induces a conformational change in prothrombin, by converting serum fibrinogen to fibrin. Polymorphic Coagulase gene (coa) could be targeted for specific typing of Staphylococcus aureus isolates (11). Coagulase enzyme consists of repeat regions in the 3' end sequence and RFLP analysis of coa gene encoding this enzyme could be very useful for Staphylococcus aureus strain typing and would serve as an excellent epidemiological marker (12). About 81 bp tandem Short Sequence Repeats (SSRs) encoding repeats of 27 amino acids in the C-terminal region together comprise the variable region of coa gene in Staphylococcus aureus. Mutation and variation in number of SSRs lead to distinct amplification of this region of coa gene by PCR. DNA fragments of different sizes obtained by digestion with specific restriction enzymes like AluI, Hae III etc. helps to discriminate various types based on the patterns produced as a result of PCR-RFLP (1). Amplification of 3’ region of coa gene produces five classes of bands expressing heterogeneity ranging from 300 bp to 800 bp. Digestion of PCR amplicons by AluI results in eight different RFLP patterns designated as coa 1-8. Most commonly encountered RFLP pattern in clinical specimens and carriers is Class 3 and coa 3 (13),(14).

Early detection and characterisation of MRSA is crucial to prevent disease transmission, appropriate management and its containment, outbreak investigation. As an epidemiological tool to understand geographic distribution, clonal relationship, disease transmission, and also its recurrence.

Only a very few studies have been done to evaluate specific genotypes by molecular characterisation of MRSA using PCR-RFLP in view of Indian context. Brakstad OG et al., (15) reported that PCR-RFLP typing methodology could trace the source of infection and routes of transmission and help to control infections and outbreaks. This technique cannot be used to distinguish MRSA and MSSA. The discriminatory index of AluI is much greater than HaeIII and it was able to discriminate unrelated strains well. PCR-RFLP was found useful, technically simple, reproducible, rapid and efficient for typing Staphylococcus aureus strains isolated from clinical specimens. Hence, the present study was undertaken to understand the utility of PCR-RFLP in molecular typing of MRSA and also to evaluate the genotypic variations among S. aureus strains.

Material and Methods

A cross-sectional study was conducted in the Department of Microbiology, from December 2018 to June 2020. Institutional Human Ethics committee clearance (Reference Number: PSG/IHEC/2019/APPR/fb/003) was obtained for this project (No. 18/338).

Inclusion criteria: A total of 150 clinical non duplicate Staphylococcus aureus isolates obtained from various clinical samples comprised the study population, which was conveniently selected from 1209 culture-positive Staphylococcus aureus isolates isolated in the Microbiology laboratory during the study period.

Exclusion criteria: Staphylococcus aureus isolates isolated from healthcare providers, environmental surveillance, patients below 18 years and those with Pulmonary tuberculosis, were excluded from the study.

Sample size calculation: Proportion, N=4PQ/d2. Where ‘P’ is the Expected prevalence; Q=100-P; d=Precision of the estimate. P=20%; Q=100-20=80%; d=5%.

Proportion, N=4×20×80/25=256.

The MRSA was identified using the routine conventional phenotypic methods namely positive catalase, tube coagulase tests and resistance to cefoxitin (30 μg). Staphylococcus aureus was detected and genotyped by coa gene PCR and coa gene PCR-RFLP, respectively. Identification of MRSA was confirmed by mecA gene PCR. I#IPVLI?I gene PCR was performed to detect CA-MRSA from HA-MRSA.

Pure DNA was extracted (15),(16) from 10 μL loopful of 16-24 hours young bacterial culture and was inoculated into 100 μL of Tris 10X lysis buffer which contains 2 μL of lysostaphin. The suspension was incubated at 37°C for 10 minutes and then boiled for 10 minutes and was then cooled to room temperature for 5 minutes. Finally centrifuged at 16000 X g for one minute. The aliquot of supernatant containing extracted DNA were used for amplification. Amplification of genes (16),(17),(18),(19) done by Veriti 96 well Conventional Thermal cycler (Applied biosystem- Thermo Fisher Scientific) PCR was employed under appropriate thermal conditions for each gene of interest (coa gene, mecA gene and I#IPVLI?I gene) as per standard reference methods discussed below. Primers were procured from Yaazh genomics, India. Amplification of coa gene (14) was done by adding 1 μL of Forward primer 5’-ATAGAGATGCTGGTACAGG-3’, 1 μL of Reverse primer 5’-GCTTCCGATTGTTCGATGC-3’, 5 μL of extracted DNA template 12.5 μL of Master mix (dNTPs, PCR buffer 10X, MgCl2, Taq DNA polymerase) and 5.5 μL of distilled water making a final reaction volume of 25 μL was used for the reaction. Specific thermal conditions for coa gene amplification was performed with the following thermocyclic conditions: a. denaturation at 94°C for 45 seconds, b. followed by 30 cycles at 94°C for 1 minute, c. annealing at 57°C for 15 seconds, d. elongation at 72°C for 15 seconds and e. final elongation at 72°C for 2 minutes. Amplification of mecA gene (15),(16),(17) was done with 1 μL of forward primer 5’-GTAGAAATGACTGAACGTCCGATAA-3’, 1 μL of reverse primer 5’-CCAATTCCACATTGTTTCGGTCTAA-3’, 12.5 μL of Master mix, 5 μL of extracted DNA template and 5.5 μL of distilled water making a final reaction volume of 25 μL was used for the reaction. Specific thermal conditions for mecA gene PCR consists of 40 cycles of a. denaturation step at 94°C for 30 seconds, b. annealing step at 55°C for 30 seconds, c. elongation step at 72°C for 1 minute and d. final elongation step at 72°C for 5 minutes. Amplification of PVL (15),(16),(17) was done by adding 1 μL of forward primer 5’- ATCATTAGGTAAAATGTCTGCACATGATCCA -3’, 1 μL of reverse primer 5’- GCATCAASTGTATTGGATAGCCAAAAGC -3’, 5 μL of extracted DNA template, 12.5μl of master mix and 5.5 μL of distilled water making a final reaction volume of 25 μL was used for the reaction. Specific thermal conditions for PVL gene detection are: a. denaturation step at 97°C for 6 minutes b. followed by 35 cycles at 92°C for 30 seconds; c. annealing step at 55°C for 30 seconds, d. elongation step at 72°C for 45 seconds and e. final elongation step carried out at 72°C for 10 minutes.

Gel electrophoresis of amplified PCR (13),(19) products of coa gene, mecA gene and I#IPVLI?I gene were analysed individually in 1.5% agarose gel prepared with 1X TBE (Tris Borate EDTA) buffer and 0.5 μg/mL ethidium bromide. The melted agarose gel was allowed to cool and solidify in the cast with comb for to create the samples well and disperse them. 10 μL of PCR product along with loading dye 2 μL of bromophenol blue were dispersed into the well create. A DNA ladder of 100 base pairs was used to measure the amplicons size and amplified product of ATCC 25923 Staphylococcus aureus control was used as positive control for each run. Electrophoresis of PCR amplicons was done for 1 hour at 100 volts and were examined under Gel doc EZ imager documentation system, Biorad. PCR-RFLP of coa gene (13) was done for coa gene in MRSA isolates. RFLP of coa gene was carried out using the AluI restriction enzyme (Sisco Research Laboratories Pvt. Ltd., India) according to the manufacturer’s recommendations. 10 μL of coa amplicons was digested with 10U of AluI enzyme along with 7.5 μL deionised water and 2 μL 10X buffer incubated at 37°C for 1 hour in a water bath. The restricted fragments were electrophoresed in 1.5% agarose gel and were analysed under automated gel documentation system.

Statistical Analysis

Data entry was made in Microsoft excel and Statistical analysis was done using International Business Machines (IBM) Statistical Package for the Social Sciences (SPSS) statistical software version 17.0.

Results

A total of 77,768 specimens were received in the Microbiology laboratory for aerobic bacterial culture and sensitivity during the study period. Culture positivity was found to be 15,129 (19.5%). Among them Staphylococcus aureus accounted for 1207 (8%) of culture positive isolates isolated from various clinical specimens received during the study period. Incidence of MRSA was found to be 388 (32.15%) among the Staphylococcus aureus isolates. Out of these, 150 Staphylococcus aureus clinical isolates isolated were conveniently selected for further study. Common sources of isolation of Staphylococcus aureus were found to be blood 50 (33.33%), wound swab 46 (30.67%), pus 34 (22.67%), tissue, tracheal aspirate, cerebrospinal fluid and others being 20 (13.3%). Total 91 (60.7%) were MSSA and 59 (39.3%) were MRSA. Total of 50 (84.7%) were from inpatients and 9 (15.3%) were outpatients out of 59 MRSA isolates. Male:Female ratio was 1.36. Age-wise distribution showed a higher incidence in 19-65 years age group as depicted (Table/Fig 1). Among the inpatients, 32 (54.2%) were admitted in the ward and remaining 18 (31%) were admitted in ICU. High incidence of MRSA isolation from clinical specimens represented Surgery department 20 (33.89%) followed by Medicine 10 (16.94%). Co-morbid conditions commonly associated with MRSA infections were diabetes mellitus (28,47.5%), systemic hypertension (20,33.9%), abscess (8,13.56%), as depicted in (Table/Fig 1).

Results of coa gene PCR for coagulase enzyme was positive for all 150 (100%) Staphylococcus aureus isolates. MecA gene (310 bp) was detected in all 59 (100%) isolates of MRSA. I#IPVLI?I gene (433 bp) was identified among 9 (15.25%) MRSA isolates and 31 (34.06%) MSSA isolates. In this study, the typing method namely coa gene PCR identified six Genotypic codes (Code I to Code VI) ranging from 300 bp-800 bp size. Restriction digestion of the amplicons of the coa gene by PCR-RFLP using the enzyme AluI provided 17 unique restriction patterns among MRSA isolates in total as depicted in (Table/Fig 2). Moreover 300 bp (Genotype code VIa), 600 bp (Genotype code IVa), 700 bp (Genotype code IIa) and 800 bp (Genotype code Ia) resulted in undigested single fragments appearing as band patterns. Double fragment patterns were observed in 800 bp (Genotype code Ib and Ic), 700 bp (Genotype code IIc and IId), 600 bp (Genotype code IVc, IVd and IVe) and 400 bp (Genotype code Va) and 300 bp (Genotype code VIb). Triple fragment patterns were seen in 700 bp (Genotype code IIb), 650 bp (Genotype code IIIa and IIIb) and 600 bp (Genotype code IVb), respectively showing enormous heterogeneity in the coa gene of S. aureus. The predominant coa gene PCR Genotype code was “Type IV” which was 600 bp size and predominant RFLP fragment for Genotype code “Type IV” was RFLP Pattern ‘b’ (500 bp, 240 bp and 140 bp fragments) (Table/Fig 3), (Table/Fig 4), (Table/Fig 5), (Table/Fig 6).

All the 59 isolates (100%) of MRSA and 91 isolates (100%) of MSSA were sensitive to vancomycin and linezolid. Quality control for susceptibility to antibiotics, performed using ATCC Staphylococcus aureus 25923 strain and was found to be satisfactory. Inducible clindamycin resistance (D test positive) was observed in 14% of MRSA and 6.7% MSSA isolates. Co-resistance among MRSA and MSSA isolates of different drugs is depicted in (Table/Fig 7).

Discussion

Hospital-Acquired MRSA (HA-MRSA) and Community-Acquired MRSA (CA-MRSA) are important public health concern causing localised skin infections to life threatening fulminant infections. Establishing the source and detection of HA-MRSA infections in healthcare facility is a challenge for both physicians and microbiologists. Methicillin resistance in MRSA is due to the presence of mutated mecA gene which encodes for penicillin binding protein 2a (PBP2a). PBP2a blocks the binding site of β-lactam antibiotics resulting in multidrug resistance. The incidence of MRSA in this study was 32.15%. In India, prevalence of MRSA varied between 23.3-59.3% (20),(21),(22),(23),(24). MRSA was more commonly isolated in 19-65 years age group, predominantly in males. The mortality due to MRSA among study population was 6.67% which was higher than MSSA (1.09%). It was similar to those studies done by Godwin PG et al., and Goh SH et al., (25),(26). The mortality rate of MRSA ranges from 5-60% (26),(27),(28) and it depends on patient population and site of infection namely infective endocarditis, skin and subcutaneous tissues, followed by invasive infections like osteomyelitis, meningitis, pneumonia, lung abscess, and empyema.

Conventional methods to identify Staphylococcus aureus, like, tube coagulase test has some pitfalls though it is routinely practiced in most of the microbiology laboratories. Phenotypic assays like Phage typing, biotyping, SDS-PAGE are available but laborious, time consuming and is available only in few reference laboratories. Whereas, molecular-based typing is much rapid, easier, specific, descriptive with high discriminative power, reproducibility and stability to establish timely diagnosis, and to initiate appropriate therapy so as to contain the epidemic. Molecular detection of coa gene confirms the diagnosis of Staphylococcus aureus with high specificity, reproducibility and rapid detection of pathogen. Typing of Staphylococcus aureus helps in characterisation and discrimination of different strains from different sources especially those from hospitals and community.

Genotypic methods like Monoplex, duplex and Multiplex PCR, Molecular beacon, DNA probe, DNA hybridisation, Amplified Restriction Fragment Polymorphism (AFLP), PCR based DNA fingerprinting technique, Plasmid profile analysis, Ribotyping, Restriction Fragment Length Polymorphism (RFLP), Real time PCR, RAPD, PFGE, SCCmec typing, MLST, Hypervariable region typing and spa typing are available for molecular detection and characterisation of MRSA. Methods like PCR-RFLP typing seems to be an alternative technique to high expensive, laborious and time consuming PFGE (2),(27). coa gene encoding coagulase enzyme is highly polymorphic as this shows difference in the amino acid sequence and number of 81 bp tandem repeats of 3’ variable end. This heterogeneity in coa gene among MRSA and MSSA isolates were analysed by PCR-RFLP. Novel coa gene PCR-RFLP for Staphylococcus aureus first introduced by Goh SH et al., in 1992 (26). In India, Tiwari HK et al., (27) were the first to attempt coa gene PCR-RFLP in the year 2008. coa gene PCR-RFLP would serve as an excellent molecular epidemiological tool as it is cheaper, simple, inexpensive and reproducible and also is helpful in analysing large number of MRSA isolates especially during outbreak investigation.

Panton-Valentine leukocidin (PVL) toxin gene (433 bp) was identified among 9 (15.25%) MRSA isolates and 31 (34.06%) MSSA in present study which was low compared on a global scale. Global prevalence of PVL toxin producing CA-MRSA strains range from 77-100% (29),(30),(31). Reports from many countries show increasing prevalence of PVL positive MRSA isolates (32),(33). Studies from India, have reported 62.85% of PVL positivity among MRSA. Another study from Mumbai by Souza ND et al., reported a prevalence of 64 % PVL positive MRSA isolates. These studies reported a higher prevalence compared to this study (34),(35). Studies done elsewhere have reported a lower prevalence (32) of PVL positive MRSA strains viz. 14.3 % in Bangladesh, 8.1 % in Saudi Arabia, 5% in France, and 4.9 % in UK (36),(37),(38),(39). PVL toxin production in CA-MRSA strains could be confirmed by lukS/F-PV genes co-amplification method (33). Adults or children infected with strains of harnessing PVL genes as a constant and stable genetic markers is primarily known to cause skin and soft tissue infections and rarely nectorising pneumonia with poor prognosis (40),(41),(42). PVL toxin serves as a genetic marker for CA-MRSA (43) strains and few studies reports that PVL is a major virulent determinant in pathogenesis of Staphylococcal infections (34),(35). PVL gene positivity in MRSA is one of the criteria to differentiate HA-MRSA from CA-MRSA where it is highly prevalent in CA-MRSA (44),(45). By identifying Sequence Type (ST), agr type, SCCmec type, and toxin gene profile these PVL positive MRSA strains could be further be typed into various clones. Most isolates harboured SCCmec type IV, a supposed marker for CA-MRSA and some HA-MRSA which is easily transmissible and commonly found (46).

In this study, six Genotype codes of coa gene were detected by PCR and 17 coa PCR-RFLP patterns using AluI enzyme among MRSA clinical isolates. Six genotypes were designated as Genotype code I to VI with coa gene bands 800 bp, 700 bp, 650 bp, 600 bp, 400 bp and 300 bp, respectively by gel electrophoresis. AluI restriction enzyme digested coa PCR products demonstrated about 17 unique restriction fragment patterns among the MRSA isolates. The predominant Coa gene PCR Genotype code was “Type IV” (600 bp) and predominant RFLP fragment for Genotype code IV is RFLP Pattern ‘b’ (500 bp, 240 bp and 140 bp fragments) was observed in the present study population. Studies done by Mahumoudi H et al., observed five different bands (300 bp, 500 bp, 600 bp, 700 bp and 800 bp). The 600-bp amplicon was observed in 150 out of 200 (75%) which was identified as coa 3 genotype predominated in S. aureus isolated from clinical and carrier specimens in by PCR-RFLP of MRSA (13). Mohajeri P et al., (46) observed five types of unique bands (810 bp, 770 bp, 740 bp, 650 bp and 490 bp) in their study. Babu NR et al., (17) studied 12 isolates of Staphylococcus aureus and reported only two types of bands (600 bp and 700 bp) after coa gene PCR-RFLP. By using coa gene PCR-RFLP, authors could very well understand the heterogeneity, pathogenicity and clinical spectrum of various CA-MRSA, HA- MRSA and MSSA infections (47). The present study also identified which particular genotype and RFLP pattern is common in specific locations especially in cases of suspected outbreaks. PCR-RFLP was performed using restriction endonuclease AluI (endonuclease enzyme obtained from strain of Arthrobacter luteus). Himabindu M et al., from southern India observed that AluI enzyme is better for genotyping of Staphylococcus aureus compared to HaeIII enzyme obtained from Haemophilus aegypticus (48). In developing countries like India with resource poor setting, we require a highly economical but more powerful and precise molecular assay like coa gene PCR-RFLP which is a simple, feasible, and precise coa typing method that would be very useful for understanding the heterogeneity and epidemiology of MRSA obtained from relevant clinical specimens.

The MRSA strains were 100% resistant to beta lactam antibiotics like penicillins and cephems. Co-resistance in MRSA was observed in ciprofloxacin 48 (81.3%), erythromycin 38 (64.40%), clindamycin 36 (61.01%), gentamicin 17 (28.81%), and cotrimoxazole 16 (27.11%) apart from resistance to penicillins, I, II and III generation cephems. Also, co-resistance with other groups of antibiotics were commonly observed in MRSA and was found to be high when compared to MSSA which was similar to studies done in other countries (49),(50). Clindamycin is considered as a useful alternative to vancomycin and other costlier antibiotics to treat both MSSA and MRSA infections. However, inducible clindamycin resistance (iMLSB phenotype) is very common and can be detected in the laboratory by ‘D test’. Inducible clindamycin resistance in MRSA was 14% and in MSSA was 6.7% in this study. Ciraj AM et al., from Manipal reported very high inducible clindamycin resistance in MRSA and MSSA (38.4%, 12.9% respectively) (50). Similarly, Vidhya R et al., have reported the incidence of inducible clindamycin resistance as 23.07% for MRSA and 3.52% for MSSA isolates (51). Current therapeutic options for MRSA are vancomycin, linezolid, teicoplanin. Alternative options are daptomycin, quinupristine-dalfopristine, cefiderocol, ceftabiprole, ceftaroline, levonadiflxacin etc.

Limitation(s)

The MRSA carriers among front line workers (staff nurses, doctors and other paramedics) were not included in the study. Evaluation of a larger sample size would help us understand the exact epidemiology, genotypic variations, drug resistance, pathogenesis and molecular characteristics of CA-MRSA and HA-MRSA. More specific and gold standard typing method like MLST was not done for coa typing due to unavailability and high cost.

Conclusion

Early and accurate identification and characterisation of MRSA both by phenotypic and genotypic typing assays are of paramount importance to identify the source and to prevent further spread. The predominantly observed MRSA coa genotype was “Genotype code IV” and RFLP pattern ‘b’ in present study.

References

1.
van Belkum A, Tassios PT, Dijkshoorn L, Haeggman S, Cookson B, Fry NK, et al. Guidelines for the validation and application of typing methods for use in bacterial epidemiology. Clin Microbiol Infect Dis. 2007;13 Suppl 3:01-46. [crossref] [PubMed]
2.
Vandamme P, Pot B, Gillis M, De Vos P, Kersters K, Swings J, et al. Polyphasic taxonomy, a consensus approach to bacterial classification. Microbiol Rev. 1996;60:407-38. [crossref] [PubMed]
3.
Gevers D, Cohan FM, Lawrence JG, Spratt BG, Coenye T, Edward J Feil, et al. Opinion: Re-evaluating prokaryotic species. Nat Rev Microbiol. 2005;3:733-39. [crossref] [PubMed]
4.
Strandén A, Frei R, Widmer AF. Molecular typing of methicillin-resistant Staphylococcus aureus: Can PCR replace pulsed-field gel electrophoresis? J Clin Microbiol. 2003;41(7):3181-86. [crossref] [PubMed]
5.
Wertheim HF, Melles DC, Vos MC, van Leeuwen W, van Belkum A, Verbrugh HA, et al. The role of nasal carriage in Staphylococcus aureus infections. The Lancet Infectious Diseases. 20051;5(12):751-62. [crossref] [PubMed]
6.
Laplana LM, Cepero MPG, Ruiz J, Zolezzi PC, Calvo MCR, Erazo MC, et al. Molecular typing of Staphylococcus aureus clinical isolates by pulsed-field gel electrophoresis, Staphylococcal cassette chromosome mec type determination and dissemination of antibiotic resistance genes. Int J Antimicrob Agents. 2007;30(6):505-13. [crossref] [PubMed]
7.
Larsen J, Enright MC, Godoy D, Spratt BG, Larsen AR, Skov RL, et al. Multilocus sequence typing scheme for Staphylococcus aureus: Revision of the gmk locus. J Clin Microbiol. 2012;50(7):2538-39. [crossref] [PubMed]
8.
Tenover FC, Arbeit R, Archer G, Biddle J, Byrne S, Goering R, et al. Comparison of traditional and molecular methods of typing isolates of Staphylococcus aureus. J Clin Microbiol. 1994;32(2):407-15. [crossref] [PubMed]
9.
Hookey JV, Richardson JF, Cookson BD. Molecular typing of Staphylococcus aureus based on PCR restriction fragment length polymorphism and DNA sequence analysis of the coagulase gene. J Clin Microbiol. 1998;36(4):1083-89. [crossref] [PubMed]
10.
Alni RH, Mohammadzadeh A, Mahmoodi P, Alikhani MY. RAPD-PCR analysis of Staphylococcus aureus strains isolated from different sources. Comp Clin Path. 2017;26(4):823-30. [crossref]
11.
Friedrich R, Panizzi P, Fuentes-Prior P, Richter K, Verhamme I, Anderson PJ, et al. Staphylocoagulase is a prototype for the mechanism of cofactor-induced zymogen activation. Nature. 2003;425(6957):535-39. [crossref] [PubMed]
12.
Wichelhaus TA, Hunfeld KP, Böddinghaus B, Kraiczy P, Schafer V, Brade V, et al. Rapid molecular typing of methicillin-resistant Staphylococcus aureus by PCR RFLP. Infect Control Hosp Epidemiol. 2001;22(05):294-98. [crossref] [PubMed]
13.
Mahmoudi H, Arabestani MR, Mousavi SF, Alikhani MY. Molecular analysis of the coagulase gene in clinical and nasal carrier isolates of methicillin-resistant Staphylococcus aureus by restriction fragment length polymorphism. J Glob Antimicrob Resist. 2017;8:41-45. [crossref] [PubMed]
14.
Hookey JV, Edwards V, Cookson BD, Richardson JF. PCR-RFLP analysis of the coagulase gene of Staphylococcus aureus: Application to the differentiation of epidemic and sporadic methicillin-resistant strains. J Hosp Infect. 1999;42(3):205-12. [crossref] [PubMed]
15.
Brakstad OG, Maeland JA, Tveren Y. Multiplex polymerase chain reaction for detection of genes for Staphylococcus aureus thermonuclease and methicillin resistance and correlation with oxacillin resistance. APMIS. 1993;101:681-88. [crossref] [PubMed]
16.
Havaei SA, Moghadam SO, Pourmand MR, Faghri J. Prevalence of genes encoding bi-component leukocidins among clinical isolates of methicillin resistant Staphylococcus aureus. Iranian Journal of Public Health. 2010;39(1):8.
17.
Babu NR, Shree GB, Rekha L, Karthiga P. Molecular analysis of Coagulase (coa) gene polymorphism in clinical isolates of Staphylococcus aureus by PCR-RFLP. Int J Innov Res Sci Eng Technol. 2014;3:8163.
18.
Louie L, Goodfellow J, Mathieu P, Glatt A, Louie M, Simor AE. Rapid detection of methicillin-resistant staphylococci from blood culture bottles by using a multiplex PCR assay. J Clin Microbiol. 2002;40(8):2786-90. [crossref] [PubMed]
19.
Murakami K, Minamide W, Wada K, Nakamura E, Teraoka H, Watanabe S. Identification of methicillin-resistant strains of staphylococci by polymerase chain reaction. J Clin Microbiol. 1991;29(10):2240-44. [crossref] [PubMed]
20.
Bindu D, Saikumar C, Vinith MV. Prevalence and antibiotic susceptibility of methicillin resistant Staphylococcus aureus isolates in a tertiary care centre. J Pharmaceutical Sci Res. 2017;9(12):2329-31.
21.
Lohan K, Sangwan J, Mane P, Lathwal S. Prevalence pattern of MRSA from a rural medical college of North India: A cause of concern. Journal of Family Medicine and Primary Care. 2021;10(2):752. [crossref] [PubMed]
22.
India SJ, Ray P, Manchanda V, Bajaj J, Chitnis DS, Gautam V, et al. Methicillin resistant Staphylococcus aureus (MRSA) in India: Prevalence & susceptibility pattern. The Indian J Med Res. 2013;137(2):363.
23.
Guillamet MCV, Vazquez R, Deaton B, Shroba J, Vazquez L, Mercier RC, et al. Host-pathogen-treatment triad: Host factors matter most in methicillin-resistant Staphylococcus aureus bacteremia outcomes. Antimicrob Agents Chemother. 2018;62(2):e01902-17. [crossref] [PubMed]
24.
Siddiqui AH, Koirala J. Methicillin Resistant Staphylococcus Aureus. [Updated 2022 May 2]. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2022.
25.
Godwin PG, Choyce A, McCarthy S. The prevalence of MRSA carriage measured over five years in a District General Hospital. J Hospital Infection. 2001;47(1):73-75. [crossref] [PubMed]
26.
Goh SH, Byrne SK, Zhang JL, Chow AW. Molecular typing of Staphylococcus aureus on the basis of coagulase gene polymorphisms. J Clin Microbiol. 1992;30(7):1642-45. [crossref] [PubMed]
27.
Tiwari HK, Sapkota D, Gaur A, Mathuria JP, Singh A, Sen MR, et al. Molecular typing of clinical Staphylococcus aureus isolates from Northern India using coaguase gene PCR-RFLP. Southeast Asian Journal of Tropical Medicine and Public Health. 2008;39(3):467.
28.
McClure J, Conly JM, Lau G. Novel multiplex PCR assay for detection of the staphylococcal virulence marker Panton-Valentine leukocidin genes and simultaneous discrimination of methicillin-susceptible from resistant staphylococci. J Clin Microbiol. 2006;44:1141-44. [crossref] [PubMed]
29.
Naimi TS, LeDell KH, Como-Sabetti K. Comparison of community and health care-associated methicillin-resistant Staphylococcus aureus infection. J Am Med Assoc. 2003;290:2976-84. [crossref] [PubMed]
30.
Prevost G, Couppie P, Prevost P. Epidemiological data on Staphylococcus aureus strains producing synergohymenotropic toxins. J Med Microbiol. 1995;42: 237-45. [crossref] [PubMed]
31.
Eckhardt C, Halvosa JS, Ray SM, Blumberg HM. Transmission of methicillin-resistant Staphylococcus aureus in the neonatal intensive care unit from a patient with community-acquired disease. Infect Control Hosp Epidemiol. 2003;24:460-61. [crossref] [PubMed]
32.
Linde H, Wagenlehner F, Strommenger B, Drubel I, Tanzer J, Reischl U, et al. Healthcare-associated outbreaks and community-acquired infections due to MRSA carrying the Panton-Valentine leukocidin gene in southeastern Germany. Eur J Clin Microbiol Infect Dis. 2005;24:419-22. [crossref] [PubMed]
33.
Kaur H, Purwar S, Saini A, Kaur H, Karadesai SG, Kholkute SD, et al. Status of methicillin resistant Staphylococcus aureus infections and evaluation of PVL producing strains in Belgium. South India JKIMSU. 2012;1:43-51.
34.
Souza ND, Rodrigues C, Mehta A. Molecular characterization of methicillin resistant Staphylococcus aureus with emergence of epidemic clones of sequence type (ST) 22 and ST 772 in Mumbai. India J Clin Microbial. 2010;48:1806-11. [crossref] [PubMed]
35.
Lina G, Piemont Y, Godail-Gamot F, Bes M, Peter MO, Gauduchon V, et al. Involvement of Panton- Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia. Clin Infect Dis. 1999;29:1128-32. [crossref] [PubMed]
36.
Holmes A, Ganner M, McGuane S, Pitt TL, Cookson BD, Kearns AM, et al. Staphylococcus aureus isolates carrying Panton-Valentine leukocidin genes in England and Wales: Frequency, characterization, and association with clinical disease. J Clin Microbiol. 2005;43:2384-90. [crossref] [PubMed]
37.
Moussa IM, Shibl AM. Molecular characterization of methicillin-resistant Staphylococcus aureus recovered from outpatient clinics in Riyadh, Saudi Arabia. Saudi Med J. 2008;30:611-17.
38.
Afroz S, Kobayashi N, Nagashima S, Alam MM, Hossain ABMB, Rahman MA, et al. Genetic characterization of Staphylococcus aureus isolates carrying Panton Valentine Leukocidin genes in Bangladesh. Jpn J Infect Dis. 2008;61:393-96.
39.
Dufour P, Gillet Y, Bes M, Lina G, Vandenesch F, Floret D, et al. Community-acquired methicillin-resistant Staphylococcus aureus infections in France: Emergence of a single clone that produces Panton-Valentine leukocidin. Clin Infect Dis. 2002;35:819-24. [crossref] [PubMed]
40.
Gillet Y, Issartel B, Vanhems P, Fournet JC, Lina G, Bes M, et al. Association between Staphylococcus aureus strains carrying gene for PantonValentine leukocidin and highly lethal necrotising pneumonia in young immunocompetent patients. Lancet. 2002;359:753-59. [crossref] [PubMed]
41.
Van der Flier M, van Dijk NB, Fluit AC, Fleer A, Wolfs TF, JP van Gest, et al. Fatal pneumonia in an adolescent due to community-acquired methicillin-resistant Staphylococcus aureus positive for Panton-Valentine leukocidin. Ned Tijdschr Geneeskd. 2003;147:1076-79.
42.
Vandenesch F, Naimi T, Enright MC, Lina G, Nimmo GR, Heffernan H, et al. Community-acquired methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes: Worldwide emergence. Emerg Infect Dis. 2003;9(8):978-84. [crossref] [PubMed]
43.
Jamklang, Boyle-Vavra S. A novel methicillin-resistant cassette in community-acquired methicillin-resistant Staphylococcus aureus isolates of diverse genetic backgrounds. J Infect Dis. 2002;186:1344-47. [crossref] [PubMed]
44.
Oliveira DC, de Lencastre H. Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococus aureus. Antimicrob. Agents Chemother. 2002;46:2155-61. [crossref] [PubMed]
45.
Deresinski S. Review of MRSA. Clin Infect Dis. 2005;40:562-73. [crossref] [PubMed]
46.
Mohajeri P, Azizkhani S, Farahani A, Norozi B. Genotyping of coa and aroA genes of methicillin-resistant staphylococcus aureus strains isolated from nasal samples in western Iran. Jundishapur J Microbiol. 2016;9(1):e26460. [crossref]
47.
Liu GY. Molecular pathogenesis of Staphylococcus aureus infection. Pediatr Res. 2009;65(5 Pt 2):71R-77R. [crossref] [PubMed]
48.
Himabindu M, Muthamilselvan DS, Bishi DK, Verma RS. Molecular analysis of coagulase gene polymorphism in clinical isolates of methicillin resistant Staphylococcus aureus by restriction fragment length polymorphism based genotyping. Am J Infect Dis. 2009;5(2):163-69. [crossref]
49.
Moolchandani K, Sastry AS, Deepashree R, Sistla S, Harish BN, Mandal J, et al. Antimicrobial resistance surveillance among intensive care units of a tertiary care hospital in Southern India. J Clin Diag Res. 2017;11(2):DC01. [crossref] [PubMed]
50.
Ciraj AM, Vinod P, Sreejith G, Rajani K. Inducible clindamycin resistance among clinical isolates of staphylococci. J Pathol Microbiol. 2009;52(1):49. [crossref] [PubMed]
52.
Vidhya R, Parimala S, Beena PM. Inducible clindamycin resistance in Staphylococcus aureus isolates from a rural tertiary care hospital, Kolar. J Clin Biomed Sci. 2013;3(3):125-28.

DOI and Others

DOI: 10.7860/JCDR/2022/57412.17021

Date of Submission: Apr 28, 2022
Date of Peer Review: Jun 14, 2022
Date of Acceptance: Aug 09, 2022
Date of Publishing: Nov 01, 2022

AUTHOR DECLARATION:
• Financial or Other Competing Interests: None
• Was Ethics Committee Approval obtained for this study? Yes
• Was informed consent obtained from the subjects involved in the study? No
• For any images presented appropriate consent has been obtained from the subjects. NA

PLAGIARISM CHECKING METHODS:
• Plagiarism X-checker: May 01, 2022
• Manual Googling: Aug 01, 2022
• iThenticate Software: Aug 06, 2022 (16%)

ETYMOLOGY: Author Origin

JCDR is now Monthly and more widely Indexed .
  • Emerging Sources Citation Index (Web of Science, thomsonreuters)
  • Index Copernicus ICV 2017: 134.54
  • Academic Search Complete Database
  • Directory of Open Access Journals (DOAJ)
  • Embase
  • EBSCOhost
  • Google Scholar
  • HINARI Access to Research in Health Programme
  • Indian Science Abstracts (ISA)
  • Journal seek Database
  • Google
  • Popline (reproductive health literature)
  • www.omnimedicalsearch.com