Community Acquired Methicillin Resistance Staphylococcus Species and Inappropriate Antibiotics use among Women of Reproductive Age Group in Enugu, Nigeria

1. Medical Doctor, Department of Medical Microbiology, College of Medicine, Enugu State University, Enugu, Nigeria. 2. Lecturer, Department of Medical Microbiology, College of Medicine, Enugu State University, Enugu, Nigeria. 3. Medical Doctor, Department of Medical Microbiology, College of Medicine, Enugu State University, Enugu, Nigeria. 4. Medical Doctor, Department of Medical Microbiology, University of Nigeria Teaching Hospital, Enugu, Nigeria. 5. Lecturer/Medical Doctor, Department of Obstetrics and Gynaecology, College of Medicine, Enugu State University of Science and Technology, Enugu, Nigeria.

Abstract

Introduction: The burden of community acquired antibiotic resistance is increasing with an alarming rate in the developing countries. Many factors, including inappropriate use of antibiotics, have been suggested as the causes of spread of resistant strains in the community.

Aim: To compare antibiotics susceptibility pattern of community acquired gram positive isolates among women of reproductive age with history of recent inappropriate antibiotics use and those with no history of antibiotics use.

Materials and Methods: The present study was a cross-sectional descriptive study carried out from August 2020 to February 2021 at the State Teaching Hospital in Enugu, Nigeria. The participants for the study were 713 apparently healthy women who presented to the family planning unit for preconception care. All the participants were screened for asymptomatic bacteriuria by culturing their Midstream Urine (MSU). The isolated organisms were identified, and Antimicrobial Susceptibility (AST) test performed using the Vitek 2. Polymerase Chain Reaction (PCR) was done for the presence of mecA gene among methicillin resistant Staphylococcus species. The antibiotic susceptibility pattern of the isolates from participants with positive history of recent antibiotic use was compared with the susceptibility pattern of those with no history of antibiotics using Chi-square test.

Results: Out of the 713 participants, 59 (8.3%) had a positive history of recent antibiotics use. Only 1 (1.7%) participant had her antibiotics prescribed by the doctor while 13 (22) and 45 (76.3) obtain their antibiotics at the patent medicine dealer shop and through self-medication respectively. The commonest indication for inappropriate use was febrile illness followed by upper respiratory symptoms. Ciprofloxacin was the most abused antibiotics followed by amoxicillin-clavulanic acid. Twenty (83.3%) and 4 (16.7%) had Asymptomatic Bacteriuria (ASB) among those with recent antibiotic use and those with no history of recent antibiotic use respectively. All the Methicillin Resistant Staphylococcus aureus (MRSA) was isolated from the participants with recent history of inappropriate antibiotic use. Also, of significant among this group were quinolone resistant gram positive organisms.

Conclusion: ASB and multidrug resistant gram positive isolates were common among the participants with recent history of inappropriate antibiotic use. There is need to regulate antibiotics use in the community to prevent selection of multidrug resistant organisms.

Febrile illness, Multidrug resistant, Quinolone resistant, Significant bacteriuria, Staphylococcus haemolyticus, Vancomycin resistant

Staphylococcus aureus and Coagulase Negative Staphylococcus Species (CoNS) are among the major causes of bacterial infection in human (1). The CoNS are increasingly responsible for diverse infections including bloodstream infection in immunocompromised and sometimes in immunocompetent patients (1). For instance, S. haemolyticus which is the second clinical important CoNS after S. epidermidis is recently referred to emerging Staphylococcus species in some studies (1),(2). Staphylococcus spp. are important in both community and hospital acquired infections. In the either of the case, the organisms are prone for developing antimicrobial resistance (2).

Globally, antimicrobial resistance is a big problem (3). The developed countries are working hard to curb it by enhanced infection control and appropriate use of antibiotics through functional antimicrobial stewardship program (3),(4). In the developing nations, however, such regulatory use of antibiotics is grossly lacking or inadequate and has led to selection of multidrug-resistance strains in the community (4). Theses strains spread freely because of poor sanitation and inadequate infection control (4).

In Nigeria, studies have shown that policies on antibiotics are rarely implemented (5). This has resulted to hawking of antibiotics in many communities, purchase antibiotics without prescription and prescription of antibiotics without absolute indication (5),(6). In such condition, targeted therapy is not often the case in many health institutions. There is extensive use broad spectrum and reserved antibiotics such as quinolones without any aetiological diagnosis and AST testing (7). Studies have shown that the commonest symptom prompting the misuse of antibiotics is febrile illness. Majority of such symptoms are caused by viruses and malaria (7),(8).

AB is common in women. It occurs in about 4% of adult women (9). In pregnant women, the prevalence is almost double and there is over 40% progression to overt Urinary Tract Infection (UTI) and complications (9). The propensity of progression in non pregnant premenopausal women is low. Therefore, the treatment of ASB is only recommended in pregnancy (9). In periconceptional evaluation, screening for ASB and treatment could go a long way to prevent complicated UTI (9).

This study was designed to compare the AST profile of community acquired gram positive organisms among participants with history of recent inappropriate antibiotic use and those that did not use antibiotics. It will also assess the prevalent of ASB in the study population. This is not often considered during preconceptional screening. The organisms were isolated from the urine of asymptomatic women of reproductive age who visited family planning unit for periconceptional care. Therefore, the aim of the study was to compare the prevalence of community acquired bacteriuria among patient with history of inappropriate use of antibiotics and those without history of recent antibiotic use. To compare AST profile in the two groups. To assess for the presence of mecA gene in the isolated methicillin resistant Staphylococcus species.

Material and Methods

The present study was a descriptive cross-sectional study designed to assess the prevalence and the determining factors of community acquired drug resistant staphylococcal and enterococcal ASB. It was carried out from August 2020 to February 2021. The targeted population was apparently well females who presented to the family planning clinic of Enugu State University Teaching Hospital, Nigeria, to access periconceptional services. Some were on one form of contraceptives for child spacing. The hospital is a major tertiary health institution in the state. It serves the state and the neighbouring southeast states on referral basis. Ethical clearance was obtained from the ethical committee of Enugu State teaching Hospital (ESUTHP/C-MAC/RA/034/vol 2/77). The purpose and objective of the study were explained to the respondents. Then, verbal consent was taken from each participant after clearly explaining the purpose of the study.

Sample size determination: A minimum sample size of 435 participants was estimated using modified Cochran formula for sample size calculation; with a 95% confidence interval, a margin of error of 4.5% and a 29.5% prevalence of ASB in Enugu as reported by Izuchukwu KE et al., (10):

The Cochran formula is where, ‘e’ is the desired level of precision, ‘p’ is the (estimated) proportion of the population which has the attribute in the study, ‘q’ is 1-p. The z-value is found in a Z table. A 10% attrition was added. However, final sample included was 713 participants in the study.

Inclusion criteria: Family planning clients who were within the reproductive age range. Participants who were on preconceptional visit. Family planning client who present to the clinic to discontinue contraception for the purpose of childbearing.

Exclusion criteria: Family planning clients who declined consent for the study after due explanation. Family planning clients with positive history of co-morbidity. Family planning clients who were on immunosuppressive drugs. The clients with significant healthcare contact (admission, works in the healthcare, cared for patents admitted in the healthcare) in the last one year were excluded.

Procedure

The participants were selected using a simple random sampling method; the research assistant wrote ‘YES’ and ‘NO’ on separate pieces of paper. The papers were folded, and the clients were asked to choose any from a small basket. Those that picked the paper with ‘YES’ on it were selected for the study. This was done on every clinic day for the period of study.

Prior to sample collection, the participants were educated on the procedure for MSU collection using sterile labelled urine container. The content of the education were the initial wiping of the vulva from the front to the back using a sterile wet gauze, parting of the labia to micturate the initial stream of urine into the toilet system and collecting the mid-stream into the provided wide lid sterile urine container before completing the micturition of the remaining urine into the water system. Approximately 10 mL of urine was collected from each participant. The samples were properly labelled. A proforma was also administered to obtain the following information: age, level of education, occupation, type of contraceptives, history of recent (at most two weeks prior to the sampling), antibiotics use, indication for antibiotic use and ‘who prescribed antibiotics’.

Sample processing: The samples were processed immediately. Each specimen was vortexed for three seconds before culturing on MacConkey agar (fluke, Switzerland ) and Blood Agar (BA) (Antec, United Kingdom) using a standard wireloop (1). On the BA, a loop full of the sample was spread uniformly on the agar plate to enable colony count for significant bacteria estimation. The plates were incubated aerobically at 37^oC for 24-48 hours. Upon incubation, significant bactiuria was estimated as previously published by Koneman textbook in Procop GW et al., (1). The cultures with ≥10⁵ colony forming unit (cfu)/mL and above were considered significant and were processed further. While cultures with <10⁵ CFU/mL were regarded as contaminants and considered non significant (1).

Microscopic examination of the urine sediments, after centrifugation at 1000 rpm for 5 minutes, was done to assess for pus cells, epithelial cells, red blood cells, cast, etc. The presence of nitrate, pH, and leucocyte esterase were also assesses using Comb-11 (Labnet, USA).

Bacteria identification and antimicrobial sensitivity: The colonies of all isolates were characterised, and gram stained. Further bacterial identification and AST were performed using the Vitek 2 System (bioMérieux, France). Antibiotic susceptibilities were interpreted according to European Committee on Antimicrobial Susceptibility Testing (EUCAST) recommendations (11). For the purpose of this study, however, the gram positive isolates were further characterised and presented.

Molecular identification of MRSA: Cefoxitin resistant Staphylococcus species (phenotypic methicillin resistant Staphylococcus species) isolates were investigated for mecA gene as previously described (12). DNA extraction was done using ZR fungal/bacterial DNA miniprep (Zymo Research) according to the manufacturer’s instructions. The PCR mix was made up of 12.5 μL of Taq 2X Master Mix from New England Biolabs (M0270); 1μL each of 10 μM forward and reverse primer; 2 μL of DNA template and 8.5 μL Nuclease free water. The primer sequence: mec A F: CTGCTATCCACCCTCAAACAG, mec A R: TCTTCGTTACTCATGCCATACA. The cycling condition was as follow; Initial denaturation at 94°C for 5 minutes, followed by 36 cycles of denaturation at 94°C for 30 seconds, annealing at 54°C for 30 seconds and elongation at 72°C for 45 seconds. Followed by a ?nal elongation step at 72°C for 7 minutes.

Statistical Analysis

The findings were analysed using International Business Machines (IBM) Statistical Package for the Social Sciences (SPSS) Statistic software for windows (SPSS statistical software V.21 (IBM Corp. 2019). Descriptive statistics were used to analyse socio-demographic details of all participants and presented in a table. Chi-square was used to compare the association between the history of recent antibiotics use and no history of antibiotic use with the independent variables. The p-value <0.05 were regarded as significant.

Results

Most of the clients were in their reproductive age group as shown in (Table/Fig 1). Their mean age was 34.65±6.48. Almost half of the participants had tertiary education while 6 (0.8%) had no formal education. Also, nearly half were traders. Civil servants contributed to 28.3% of the clients. Over 96.4 of the participants were married and 541 (75.9) clients visited the unit for the purpose of child spacing. Implant (Implanon and Jadelle) was the common type of contraceptive used by the clients (386, 54.1%).

(Table/Fig 2) represented the history of recent antibiotics use. Out of 59 (8.3%) clients who used antibiotics, only 1 (1.7%) obtained the drug from the hospital, 45 (76.3%) and 13 (22%) used the antibiotics inappropriately by self-medication and without prescriptions respectively. Over 86.4% of the antibiotic use was not supported by laboratory diagnosis or antimicrobial sensitivity assessment. The commonest indication for antibiotic use was a febrile illness, 43 (72.9) followed by sore throat, 15 (25.4%). Ciprofloxacin was the commonly used antibiotic, contributing to over half of all the antibiotics used by the participants. This was followed by amoxicillin-clavulanic acid.

The (Table/Fig 3) represents the gram reactions of all the isolates. The antibiotic sensitivity profiles of the isolated organisms were shown in (Table/Fig 4). Two out of nine Staphylococcus aureus were cefoxitin sensitive {Methicillin Sensitive Staphylococcus aureus (MSSA)}. Two Staphylococcus aureus each were Vancomycin Sensitive (VSSA) and Vancomycin Intermediate (VISA) respectively. Most of the organisms were sensitive to nitrofurantoin, linezolid, quinupristin/dalfopristin, and tigecycline. Almost all the isolates were resistant to quinolone. A total of 11 methicillin resistant Staphylococcus species were isolated and all of them expressed the mecA gene as shown in (Table/Fig 5).

(Table/Fig 6) showed the association between inappropriate use of antibiotics and age, level of education, and occupation of the client, and found no significant difference. The table also represented the relationship of uropathogens isolation and inappropriate antibiotic use. Uropathogens are more likely to be isolated from clients with a recent history of antibiotics use than those with no such history. There was a significant association (p-value=0.001) between inappropriate use of antibiotics and isolating MRSA.

Discussion

The burden of community acquired antibiotic resistance is increasing in developing countries because of the inappropriate use of antibiotics especially in the treatment of non bacterial infectious conditions such as upper respiratory tract infection, viral and parasitic febrile illnesses, and viral diarrhoeal diseases (13),(14). The choice of family planning clients as the study population was informed by their negligible contact with the healthcare environment as previously documented (15). The unit is often situated at the outpatient unit and sometimes outside the healthcare facilities where the clients have no contact with the patients (15). Also, the majority of the women who visit this facility were in their reproductive age group. In Nigeria, the commonest indication for contraception is child spacing (4). This means that many of the clients could seek for reversal of contraception to enable them to get pregnant. In present study, the participants were on their preconception visits (16).

This study observed that 24 (3.4%) of the participants had significant bacteriuria due to gram positive organisms with Staphylococcus aureus predominating. This finding obtained was similar to studies among pregnant women (17),(18). Studies have shown that ASB in pregnant women has over 50% chance of progressing to UTI but in non-pregnant adults, the probability reduces to 30% (16),(17),(18). The complication and the burden in terms of morbidity and mortality to both mother and child also increase with pregnancy. This is due to both hormonal and structural changes in the urinary tract due to pregnancy (19). No available study has shown the outcome of ABU in periconceptional women when they eventually become pregnant. Many physicians however screen and treat ABU in women expecting conception to prevent the detrimental complication associated with UTI in early pregnancy (19),(20).

Many studies in the country have reported increasing inappropriate use of antimicrobial (13),(14),(21), with a higher proportion occurring in the community where antibiotics are hawked without regulations (22),(23). As seen in present study, only one participant had her antibiotic prescribed in the hospital. This is against the World Health Organisation (WHO) recommendation and global action on the implementation of an antimicrobial stewardship program (24). Many have argued that such programs can only yield the desired result in developing countries when community participation is entrenched (5),(24). From most studies, the commonest indication for irrational use of antibiotics is febrile illnesses and upper respiratory tract infection (5),(24). Febrile illness in Nigeria is usually viral or parasitic in aetiology, and they do not require antibiotics. Antibiotics stewardship on the other hand requires that the indication for antimicrobial most be defined and evidenced-based. It should be supported by the appropriate laboratory investigation (5),(24). This was not the case in this study where only one participant had a doctors’ prescription, and few participants had a laboratory test before commencing antibiotics. Although the laboratory test is no longer recommended for the diagnosis of enteric fever (25).

Nigeria is one of the countries known for the misuse of fluoroquinolones (26). This involves unregulated access and availability of the drug and the use of substandard and spurious quality of oral ciprofloxacin formulations. It is thought that such use contributed toward increased risk of treatment failure and bacterial resistance in developing countries (26). The reason for the inappropriate use is high bioavailability, oral formulation, and ease to administer, and its broad-spectrum activity (26). In present study, ciprofloxacin was the commonly abused drug. Some studies highlighted that it is the second most misused drug in the country following closely the beta-lactams (ampicillin and amoxicillin) (27),(28). The beta-lactams have become the second with an amoxicillin-clavulanic acid, which has a broader spectrum of activity, preferred than ampicillin. This supports the observation by WHO that the world is exhausting its reserve of antibiotics (7).

These frequently irrationally used antibiotics are broad-spectrum, with the unfortunate ability to induce selective adaptation to multi-drug resistant strains and promote also promote their dominance and spread in communities. This is essential in areas with poor infection control (28). Ciprofloxacin and other fluoroquinolones are among the restricted antibiotics but its unregulated use could be responsible for its increasing resistance among the gram-positive, gram-negatives, Mycobacterium tuberculosis, etc., (28). In this study, multidrug resistant gram positive organisms were higher in the urine of the participants with a recent history of inappropriate use of antibiotics. Methicillin and quinolone resistant Staphylococcus were frequently isolated among this group. Also, isolate were vancomycin resistant Enterococcus species such findings have been widely reported in the hospital setting but rarely in the community. Their burden is enormous including increased hospital stay, cost, failure of treatment and increased side-effect (29). Clinicians usually consider the burden of resistant organisms in their choice of empirical treatment in healthcare associated infections, but such considerations are often not made on community acquired infections (29),(30).

Limitation(s)

As in all cross-sectional studies, other factors that contribute to antimicrobial resistant in the community many not have been assessed. Present study also did not assess the effect of the various contraception on the antimicrobial profile of the clients. Also, follow-up the women to know if the isolated organisms were transient colonisers of their UTI. However, the finding of this study will be vital in further investigation in the area.

Conclusion

Majority of the participants with the history of antibiotic use obtained the antibiotics without doctor’s prescription. Quinolone was frequently used antibiotics followed by amoxicillin-clavulanic acid. The commonest indication for antibiotic use was febrile illness. Methicillin resistant and quinolone resistant Staphylococcus and Enterococcus spp. bacteriuria were common among the participants with positive history of antibiotics use. There is need to regulate the use of antibiotics in the community through awareness and policy implementation.

Author’s contributions: CN supported the study design, led the analysis and drafted the paper; ECA participated in the data collection and helped with analysis; STC participated in the data collection and helped with analysis; PCN participated in data collection, analysis; NEM assisted in analysis and reviewed the draft paper; All authors read and approved the final manuscript.

Acknowledgement

Authors would like to thank the participants who gave consent for this study. Authors would also appreciate the field teams who coordinated Imanyikwa Eucharia Oluchi for administering the sample collection, and Onuabuchi Gift Chimnaecherem who helped in Statistical analysis.

DOI and Others

DOI: 10.7860/JCDR/2022/52980.16898

Date of Submission: Oct 22, 2021
Date of Peer Review: Dec 03, 2021
Date of Acceptance: Jan 03, 2022
Date of Publishing: Sep 01, 2022

AUTHOR DECLARATION:
• Financial or Other Competing Interests: None
• Was Ethics Committee Approval obtained for this study? Yes
• Was informed consent obtained from the subjects involved in the study? Yes
• For any images presented appropriate consent has been obtained from the subjects. NA

PLAGIARISM CHECKING METHODS:
• Plagiarism X-checker: Oct 26, 2021
• Manual Googling: Dec 14, 2021
• iThenticate Software: Aug 08, 2022 (9%)

ETYMOLOGY: Author Origin