Journal of Clinical and Diagnostic Research, ISSN - 0973 - 709X

Users Online : 126973

AbstractMaterial and MethodsResultsDiscussionConclusionAcknowledgementReferencesDOI and Others
Article in PDF How to Cite Citation Manager Readers' Comments (0) Audio Visual Article Statistics Link to PUBMED Print this Article Send to a Friend
Advertisers Access Statistics Resources

Dr Mohan Z Mani

"Thank you very much for having published my article in record time.I would like to compliment you and your entire staff for your promptness, courtesy, and willingness to be customer friendly, which is quite unusual.I was given your reference by a colleague in pathology,and was able to directly phone your editorial office for clarifications.I would particularly like to thank the publication managers and the Assistant Editor who were following up my article. I would also like to thank you for adjusting the money I paid initially into payment for my modified article,and refunding the balance.
I wish all success to your journal and look forward to sending you any suitable similar article in future"



Dr Mohan Z Mani,
Professor & Head,
Department of Dermatolgy,
Believers Church Medical College,
Thiruvalla, Kerala
On Sep 2018




Prof. Somashekhar Nimbalkar

"Over the last few years, we have published our research regularly in Journal of Clinical and Diagnostic Research. Having published in more than 20 high impact journals over the last five years including several high impact ones and reviewing articles for even more journals across my fields of interest, we value our published work in JCDR for their high standards in publishing scientific articles. The ease of submission, the rapid reviews in under a month, the high quality of their reviewers and keen attention to the final process of proofs and publication, ensure that there are no mistakes in the final article. We have been asked clarifications on several occasions and have been happy to provide them and it exemplifies the commitment to quality of the team at JCDR."



Prof. Somashekhar Nimbalkar
Head, Department of Pediatrics, Pramukhswami Medical College, Karamsad
Chairman, Research Group, Charutar Arogya Mandal, Karamsad
National Joint Coordinator - Advanced IAP NNF NRP Program
Ex-Member, Governing Body, National Neonatology Forum, New Delhi
Ex-President - National Neonatology Forum Gujarat State Chapter
Department of Pediatrics, Pramukhswami Medical College, Karamsad, Anand, Gujarat.
On Sep 2018




Dr. Kalyani R

"Journal of Clinical and Diagnostic Research is at present a well-known Indian originated scientific journal which started with a humble beginning. I have been associated with this journal since many years. I appreciate the Editor, Dr. Hemant Jain, for his constant effort in bringing up this journal to the present status right from the scratch. The journal is multidisciplinary. It encourages in publishing the scientific articles from postgraduates and also the beginners who start their career. At the same time the journal also caters for the high quality articles from specialty and super-specialty researchers. Hence it provides a platform for the scientist and researchers to publish. The other aspect of it is, the readers get the information regarding the most recent developments in science which can be used for teaching, research, treating patients and to some extent take preventive measures against certain diseases. The journal is contributing immensely to the society at national and international level."



Dr Kalyani R
Professor and Head
Department of Pathology
Sri Devaraj Urs Medical College
Sri Devaraj Urs Academy of Higher Education and Research , Kolar, Karnataka
On Sep 2018




Dr. Saumya Navit

"As a peer-reviewed journal, the Journal of Clinical and Diagnostic Research provides an opportunity to researchers, scientists and budding professionals to explore the developments in the field of medicine and dentistry and their varied specialities, thus extending our view on biological diversities of living species in relation to medicine.
‘Knowledge is treasure of a wise man.’ The free access of this journal provides an immense scope of learning for the both the old and the young in field of medicine and dentistry as well. The multidisciplinary nature of the journal makes it a better platform to absorb all that is being researched and developed. The publication process is systematic and professional. Online submission, publication and peer reviewing makes it a user-friendly journal.
As an experienced dentist and an academician, I proudly recommend this journal to the dental fraternity as a good quality open access platform for rapid communication of their cutting-edge research progress and discovery.
I wish JCDR a great success and I hope that journal will soar higher with the passing time."



Dr Saumya Navit
Professor and Head
Department of Pediatric Dentistry
Saraswati Dental College
Lucknow
On Sep 2018




Dr. Arunava Biswas

"My sincere attachment with JCDR as an author as well as reviewer is a learning experience . Their systematic approach in publication of article in various categories is really praiseworthy.
Their prompt and timely response to review's query and the manner in which they have set the reviewing process helps in extracting the best possible scientific writings for publication.
It's a honour and pride to be a part of the JCDR team. My very best wishes to JCDR and hope it will sparkle up above the sky as a high indexed journal in near future."



Dr. Arunava Biswas
MD, DM (Clinical Pharmacology)
Assistant Professor
Department of Pharmacology
Calcutta National Medical College & Hospital , Kolkata




Dr. C.S. Ramesh Babu
" Journal of Clinical and Diagnostic Research (JCDR) is a multi-specialty medical and dental journal publishing high quality research articles in almost all branches of medicine. The quality of printing of figures and tables is excellent and comparable to any International journal. An added advantage is nominal publication charges and monthly issue of the journal and more chances of an article being accepted for publication. Moreover being a multi-specialty journal an article concerning a particular specialty has a wider reach of readers of other related specialties also. As an author and reviewer for several years I find this Journal most suitable and highly recommend this Journal."
Best regards,
C.S. Ramesh Babu,
Associate Professor of Anatomy,
Muzaffarnagar Medical College,
Muzaffarnagar.
On Aug 2018




Dr. Arundhathi. S
"Journal of Clinical and Diagnostic Research (JCDR) is a reputed peer reviewed journal and is constantly involved in publishing high quality research articles related to medicine. Its been a great pleasure to be associated with this esteemed journal as a reviewer and as an author for a couple of years. The editorial board consists of many dedicated and reputed experts as its members and they are doing an appreciable work in guiding budding researchers. JCDR is doing a commendable job in scientific research by promoting excellent quality research & review articles and case reports & series. The reviewers provide appropriate suggestions that improve the quality of articles. I strongly recommend my fraternity to encourage JCDR by contributing their valuable research work in this widely accepted, user friendly journal. I hope my collaboration with JCDR will continue for a long time".



Dr. Arundhathi. S
MBBS, MD (Pathology),
Sanjay Gandhi institute of trauma and orthopedics,
Bengaluru.
On Aug 2018




Dr. Mamta Gupta,
"It gives me great pleasure to be associated with JCDR, since last 2-3 years. Since then I have authored, co-authored and reviewed about 25 articles in JCDR. I thank JCDR for giving me an opportunity to improve my own skills as an author and a reviewer.
It 's a multispecialty journal, publishing high quality articles. It gives a platform to the authors to publish their research work which can be available for everyone across the globe to read. The best thing about JCDR is that the full articles of all medical specialties are available as pdf/html for reading free of cost or without institutional subscription, which is not there for other journals. For those who have problem in writing manuscript or do statistical work, JCDR comes for their rescue.
The journal has a monthly publication and the articles are published quite fast. In time compared to other journals. The on-line first publication is also a great advantage and facility to review one's own articles before going to print. The response to any query and permission if required, is quite fast; this is quite commendable. I have a very good experience about seeking quick permission for quoting a photograph (Fig.) from a JCDR article for my chapter authored in an E book. I never thought it would be so easy. No hassles.
Reviewing articles is no less a pain staking process and requires in depth perception, knowledge about the topic for review. It requires time and concentration, yet I enjoy doing it. The JCDR website especially for the reviewers is quite user friendly. My suggestions for improving the journal is, more strict review process, so that only high quality articles are published. I find a a good number of articles in Obst. Gynae, hence, a new journal for this specialty titled JCDR-OG can be started. May be a bimonthly or quarterly publication to begin with. Only selected articles should find a place in it.
An yearly reward for the best article authored can also incentivize the authors. Though the process of finding the best article will be not be very easy. I do not know how reviewing process can be improved. If an article is being reviewed by two reviewers, then opinion of one can be communicated to the other or the final opinion of the editor can be communicated to the reviewer if requested for. This will help one’s reviewing skills.
My best wishes to Dr. Hemant Jain and all the editorial staff of JCDR for their untiring efforts to bring out this journal. I strongly recommend medical fraternity to publish their valuable research work in this esteemed journal, JCDR".



Dr. Mamta Gupta
Consultant
(Ex HOD Obs &Gynae, Hindu Rao Hospital and associated NDMC Medical College, Delhi)
Aug 2018




Dr. Rajendra Kumar Ghritlaharey

"I wish to thank Dr. Hemant Jain, Editor-in-Chief Journal of Clinical and Diagnostic Research (JCDR), for asking me to write up few words.
Writing is the representation of language in a textual medium i e; into the words and sentences on paper. Quality medical manuscript writing in particular, demands not only a high-quality research, but also requires accurate and concise communication of findings and conclusions, with adherence to particular journal guidelines. In medical field whether working in teaching, private, or in corporate institution, everyone wants to excel in his / her own field and get recognised by making manuscripts publication.


Authors are the souls of any journal, and deserve much respect. To publish a journal manuscripts are needed from authors. Authors have a great responsibility for producing facts of their work in terms of number and results truthfully and an individual honesty is expected from authors in this regards. Both ways its true "No authors-No manuscripts-No journals" and "No journals–No manuscripts–No authors". Reviewing a manuscript is also a very responsible and important task of any peer-reviewed journal and to be taken seriously. It needs knowledge on the subject, sincerity, honesty and determination. Although the process of reviewing a manuscript is a time consuming task butit is expected to give one's best remarks within the time frame of the journal.
Salient features of the JCDR: It is a biomedical, multidisciplinary (including all medical and dental specialities), e-journal, with wide scope and extensive author support. At the same time, a free text of manuscript is available in HTML and PDF format. There is fast growing authorship and readership with JCDR as this can be judged by the number of articles published in it i e; in Feb 2007 of its first issue, it contained 5 articles only, and now in its recent volume published in April 2011, it contained 67 manuscripts. This e-journal is fulfilling the commitments and objectives sincerely, (as stated by Editor-in-chief in his preface to first edition) i e; to encourage physicians through the internet, especially from the developing countries who witness a spectrum of disease and acquire a wealth of knowledge to publish their experiences to benefit the medical community in patients care. I also feel that many of us have work of substance, newer ideas, adequate clinical materials but poor in medical writing and hesitation to submit the work and need help. JCDR provides authors help in this regards.
Timely publication of journal: Publication of manuscripts and bringing out the issue in time is one of the positive aspects of JCDR and is possible with strong support team in terms of peer reviewers, proof reading, language check, computer operators, etc. This is one of the great reasons for authors to submit their work with JCDR. Another best part of JCDR is "Online first Publications" facilities available for the authors. This facility not only provides the prompt publications of the manuscripts but at the same time also early availability of the manuscripts for the readers.
Indexation and online availability: Indexation transforms the journal in some sense from its local ownership to the worldwide professional community and to the public.JCDR is indexed with Embase & EMbiology, Google Scholar, Index Copernicus, Chemical Abstracts Service, Journal seek Database, Indian Science Abstracts, to name few of them. Manuscriptspublished in JCDR are available on major search engines ie; google, yahoo, msn.
In the era of fast growing newer technologies, and in computer and internet friendly environment the manuscripts preparation, submission, review, revision, etc and all can be done and checked with a click from all corer of the world, at any time. Of course there is always a scope for improvement in every field and none is perfect. To progress, one needs to identify the areas of one's weakness and to strengthen them.
It is well said that "happy beginning is half done" and it fits perfectly with JCDR. It has grown considerably and I feel it has already grown up from its infancy to adolescence, achieving the status of standard online e-journal form Indian continent since its inception in Feb 2007. This had been made possible due to the efforts and the hard work put in it. The way the JCDR is improving with every new volume, with good quality original manuscripts, makes it a quality journal for readers. I must thank and congratulate Dr Hemant Jain, Editor-in-Chief JCDR and his team for their sincere efforts, dedication, and determination for making JCDR a fast growing journal.
Every one of us: authors, reviewers, editors, and publisher are responsible for enhancing the stature of the journal. I wish for a great success for JCDR."



Thanking you
With sincere regards
Dr. Rajendra Kumar Ghritlaharey, M.S., M. Ch., FAIS
Associate Professor,
Department of Paediatric Surgery, Gandhi Medical College & Associated
Kamla Nehru & Hamidia Hospitals Bhopal, Madhya Pradesh 462 001 (India)
E-mail: drrajendrak1@rediffmail.com
On May 11,2011




Dr. Shankar P.R.

"On looking back through my Gmail archives after being requested by the journal to write a short editorial about my experiences of publishing with the Journal of Clinical and Diagnostic Research (JCDR), I came across an e-mail from Dr. Hemant Jain, Editor, in March 2007, which introduced the new electronic journal. The main features of the journal which were outlined in the e-mail were extensive author support, cash rewards, the peer review process, and other salient features of the journal.
Over a span of over four years, we (I and my colleagues) have published around 25 articles in the journal. In this editorial, I plan to briefly discuss my experiences of publishing with JCDR and the strengths of the journal and to finally address the areas for improvement.
My experiences of publishing with JCDR: Overall, my experiences of publishing withJCDR have been positive. The best point about the journal is that it responds to queries from the author. This may seem to be simple and not too much to ask for, but unfortunately, many journals in the subcontinent and from many developing countries do not respond or they respond with a long delay to the queries from the authors 1. The reasons could be many, including lack of optimal secretarial and other support. Another problem with many journals is the slowness of the review process. Editorial processing and peer review can take anywhere between a year to two years with some journals. Also, some journals do not keep the contributors informed about the progress of the review process. Due to the long review process, the articles can lose their relevance and topicality. A major benefit with JCDR is the timeliness and promptness of its response. In Dr Jain's e-mail which was sent to me in 2007, before the introduction of the Pre-publishing system, he had stated that he had received my submission and that he would get back to me within seven days and he did!
Most of the manuscripts are published within 3 to 4 months of their submission if they are found to be suitable after the review process. JCDR is published bimonthly and the accepted articles were usually published in the next issue. Recently, due to the increased volume of the submissions, the review process has become slower and it ?? Section can take from 4 to 6 months for the articles to be reviewed. The journal has an extensive author support system and it has recently introduced a paid expedited review process. The journal also mentions the average time for processing the manuscript under different submission systems - regular submission and expedited review.
Strengths of the journal: The journal has an online first facility in which the accepted manuscripts may be published on the website before being included in a regular issue of the journal. This cuts down the time between their acceptance and the publication. The journal is indexed in many databases, though not in PubMed. The editorial board should now take steps to index the journal in PubMed. The journal has a system of notifying readers through e-mail when a new issue is released. Also, the articles are available in both the HTML and the PDF formats. I especially like the new and colorful page format of the journal. Also, the access statistics of the articles are available. The prepublication and the manuscript tracking system are also helpful for the authors.
Areas for improvement: In certain cases, I felt that the peer review process of the manuscripts was not up to international standards and that it should be strengthened. Also, the number of manuscripts in an issue is high and it may be difficult for readers to go through all of them. The journal can consider tightening of the peer review process and increasing the quality standards for the acceptance of the manuscripts. I faced occasional problems with the online manuscript submission (Pre-publishing) system, which have to be addressed.
Overall, the publishing process with JCDR has been smooth, quick and relatively hassle free and I can recommend other authors to consider the journal as an outlet for their work."



Dr. P. Ravi Shankar
KIST Medical College, P.O. Box 14142, Kathmandu, Nepal.
E-mail: ravi.dr.shankar@gmail.com
On April 2011
Anuradha

Dear team JCDR, I would like to thank you for the very professional and polite service provided by everyone at JCDR. While i have been in the field of writing and editing for sometime, this has been my first attempt in publishing a scientific paper.Thank you for hand-holding me through the process.


Dr. Anuradha
E-mail: anuradha2nittur@gmail.com
On Jan 2020

Important Notice

Original article / research
Year : 2022 | Month : September | Volume : 16 | Issue : 9 | Page : DC18 - DC23 Full Version

Community Acquired Methicillin Resistance Staphylococcus Species and Inappropriate Antibiotics use among Women of Reproductive Age Group in Enugu, Nigeria


Published: September 1, 2022 | DOI: https://doi.org/10.7860/JCDR/2022/52980.16898
Chukwuemeka Nwangwu, Emmanuel Chike Amadi, Stella Tochukwu Chukwuma, Promise Chidiebere Ndubueze, Nwaeze Ezenwaeze Malachy

1. Medical Doctor, Department of Medical Microbiology, College of Medicine, Enugu State University, Enugu, Nigeria. 2. Lecturer, Department of Medical Microbiology, College of Medicine, Enugu State University, Enugu, Nigeria. 3. Medical Doctor, Department of Medical Microbiology, College of Medicine, Enugu State University, Enugu, Nigeria. 4. Medical Doctor, Department of Medical Microbiology, University of Nigeria Teaching Hospital, Enugu, Nigeria. 5. Lecturer/Medical Doctor, Department of Obstetrics and Gynaecology, College of Medicine, Enugu State University of Science and Technology, Enugu, Nigeria.

Correspondence Address :
Dr. Chukwuemeka Nwangwu,
Agbani Road, Enugu, Nigeria.
E-mail: chijoke.nwangwu@esut.edu.ng

Abstract

Introduction: The burden of community acquired antibiotic resistance is increasing with an alarming rate in the developing countries. Many factors, including inappropriate use of antibiotics, have been suggested as the causes of spread of resistant strains in the community.

Aim: To compare antibiotics susceptibility pattern of community acquired gram positive isolates among women of reproductive age with history of recent inappropriate antibiotics use and those with no history of antibiotics use.

Materials and Methods: The present study was a cross-sectional descriptive study carried out from August 2020 to February 2021 at the State Teaching Hospital in Enugu, Nigeria. The participants for the study were 713 apparently healthy women who presented to the family planning unit for preconception care. All the participants were screened for asymptomatic bacteriuria by culturing their Midstream Urine (MSU). The isolated organisms were identified, and Antimicrobial Susceptibility (AST) test performed using the Vitek 2. Polymerase Chain Reaction (PCR) was done for the presence of mecA gene among methicillin resistant Staphylococcus species. The antibiotic susceptibility pattern of the isolates from participants with positive history of recent antibiotic use was compared with the susceptibility pattern of those with no history of antibiotics using Chi-square test.

Results: Out of the 713 participants, 59 (8.3%) had a positive history of recent antibiotics use. Only 1 (1.7%) participant had her antibiotics prescribed by the doctor while 13 (22) and 45 (76.3) obtain their antibiotics at the patent medicine dealer shop and through self-medication respectively. The commonest indication for inappropriate use was febrile illness followed by upper respiratory symptoms. Ciprofloxacin was the most abused antibiotics followed by amoxicillin-clavulanic acid. Twenty (83.3%) and 4 (16.7%) had Asymptomatic Bacteriuria (ASB) among those with recent antibiotic use and those with no history of recent antibiotic use respectively. All the Methicillin Resistant Staphylococcus aureus (MRSA) was isolated from the participants with recent history of inappropriate antibiotic use. Also, of significant among this group were quinolone resistant gram positive organisms.

Conclusion: ASB and multidrug resistant gram positive isolates were common among the participants with recent history of inappropriate antibiotic use. There is need to regulate antibiotics use in the community to prevent selection of multidrug resistant organisms.

Keywords

Febrile illness, Multidrug resistant, Quinolone resistant, Significant bacteriuria, Staphylococcus haemolyticus, Vancomycin resistant

Staphylococcus aureus and Coagulase Negative Staphylococcus Species (CoNS) are among the major causes of bacterial infection in human (1). The CoNS are increasingly responsible for diverse infections including bloodstream infection in immunocompromised and sometimes in immunocompetent patients (1). For instance, S. haemolyticus which is the second clinical important CoNS after S. epidermidis is recently referred to emerging Staphylococcus species in some studies (1),(2). Staphylococcus spp. are important in both community and hospital acquired infections. In the either of the case, the organisms are prone for developing antimicrobial resistance (2).

Globally, antimicrobial resistance is a big problem (3). The developed countries are working hard to curb it by enhanced infection control and appropriate use of antibiotics through functional antimicrobial stewardship program (3),(4). In the developing nations, however, such regulatory use of antibiotics is grossly lacking or inadequate and has led to selection of multidrug-resistance strains in the community (4). Theses strains spread freely because of poor sanitation and inadequate infection control (4).

In Nigeria, studies have shown that policies on antibiotics are rarely implemented (5). This has resulted to hawking of antibiotics in many communities, purchase antibiotics without prescription and prescription of antibiotics without absolute indication (5),(6). In such condition, targeted therapy is not often the case in many health institutions. There is extensive use broad spectrum and reserved antibiotics such as quinolones without any aetiological diagnosis and AST testing (7). Studies have shown that the commonest symptom prompting the misuse of antibiotics is febrile illness. Majority of such symptoms are caused by viruses and malaria (7),(8).

AB is common in women. It occurs in about 4% of adult women (9). In pregnant women, the prevalence is almost double and there is over 40% progression to overt Urinary Tract Infection (UTI) and complications (9). The propensity of progression in non pregnant premenopausal women is low. Therefore, the treatment of ASB is only recommended in pregnancy (9). In periconceptional evaluation, screening for ASB and treatment could go a long way to prevent complicated UTI (9).

This study was designed to compare the AST profile of community acquired gram positive organisms among participants with history of recent inappropriate antibiotic use and those that did not use antibiotics. It will also assess the prevalent of ASB in the study population. This is not often considered during preconceptional screening. The organisms were isolated from the urine of asymptomatic women of reproductive age who visited family planning unit for periconceptional care. Therefore, the aim of the study was to compare the prevalence of community acquired bacteriuria among patient with history of inappropriate use of antibiotics and those without history of recent antibiotic use. To compare AST profile in the two groups. To assess for the presence of mecA gene in the isolated methicillin resistant Staphylococcus species.

Material and Methods

The present study was a descriptive cross-sectional study designed to assess the prevalence and the determining factors of community acquired drug resistant staphylococcal and enterococcal ASB. It was carried out from August 2020 to February 2021. The targeted population was apparently well females who presented to the family planning clinic of Enugu State University Teaching Hospital, Nigeria, to access periconceptional services. Some were on one form of contraceptives for child spacing. The hospital is a major tertiary health institution in the state. It serves the state and the neighbouring southeast states on referral basis. Ethical clearance was obtained from the ethical committee of Enugu State teaching Hospital (ESUTHP/C-MAC/RA/034/vol 2/77). The purpose and objective of the study were explained to the respondents. Then, verbal consent was taken from each participant after clearly explaining the purpose of the study.

Sample size determination: A minimum sample size of 435 participants was estimated using modified Cochran formula for sample size calculation; with a 95% confidence interval, a margin of error of 4.5% and a 29.5% prevalence of ASB in Enugu as reported by Izuchukwu KE et al., (10):

The Cochran formula is where, ‘e’ is the desired level of precision, ‘p’ is the (estimated) proportion of the population which has the attribute in the study, ‘q’ is 1-p. The z-value is found in a Z table. A 10% attrition was added. However, final sample included was 713 participants in the study.

Inclusion criteria: Family planning clients who were within the reproductive age range. Participants who were on preconceptional visit. Family planning client who present to the clinic to discontinue contraception for the purpose of childbearing.

Exclusion criteria: Family planning clients who declined consent for the study after due explanation. Family planning clients with positive history of co-morbidity. Family planning clients who were on immunosuppressive drugs. The clients with significant healthcare contact (admission, works in the healthcare, cared for patents admitted in the healthcare) in the last one year were excluded.

Procedure

The participants were selected using a simple random sampling method; the research assistant wrote ‘YES’ and ‘NO’ on separate pieces of paper. The papers were folded, and the clients were asked to choose any from a small basket. Those that picked the paper with ‘YES’ on it were selected for the study. This was done on every clinic day for the period of study.

Prior to sample collection, the participants were educated on the procedure for MSU collection using sterile labelled urine container. The content of the education were the initial wiping of the vulva from the front to the back using a sterile wet gauze, parting of the labia to micturate the initial stream of urine into the toilet system and collecting the mid-stream into the provided wide lid sterile urine container before completing the micturition of the remaining urine into the water system. Approximately 10 mL of urine was collected from each participant. The samples were properly labelled. A proforma was also administered to obtain the following information: age, level of education, occupation, type of contraceptives, history of recent (at most two weeks prior to the sampling), antibiotics use, indication for antibiotic use and ‘who prescribed antibiotics’.

Sample processing: The samples were processed immediately. Each specimen was vortexed for three seconds before culturing on MacConkey agar (fluke, Switzerland ) and Blood Agar (BA) (Antec, United Kingdom) using a standard wireloop (1). On the BA, a loop full of the sample was spread uniformly on the agar plate to enable colony count for significant bacteria estimation. The plates were incubated aerobically at 37oC for 24-48 hours. Upon incubation, significant bactiuria was estimated as previously published by Koneman textbook in Procop GW et al., (1). The cultures with ≥105 colony forming unit (cfu)/mL and above were considered significant and were processed further. While cultures with <105 CFU/mL were regarded as contaminants and considered non significant (1).

Microscopic examination of the urine sediments, after centrifugation at 1000 rpm for 5 minutes, was done to assess for pus cells, epithelial cells, red blood cells, cast, etc. The presence of nitrate, pH, and leucocyte esterase were also assesses using Comb-11 (Labnet, USA).

Bacteria identification and antimicrobial sensitivity: The colonies of all isolates were characterised, and gram stained. Further bacterial identification and AST were performed using the Vitek 2 System (bioMérieux, France). Antibiotic susceptibilities were interpreted according to European Committee on Antimicrobial Susceptibility Testing (EUCAST) recommendations (11). For the purpose of this study, however, the gram positive isolates were further characterised and presented.

Molecular identification of MRSA: Cefoxitin resistant Staphylococcus species (phenotypic methicillin resistant Staphylococcus species) isolates were investigated for mecA gene as previously described (12). DNA extraction was done using ZR fungal/bacterial DNA miniprep (Zymo Research) according to the manufacturer’s instructions. The PCR mix was made up of 12.5 μL of Taq 2X Master Mix from New England Biolabs (M0270); 1μL each of 10 μM forward and reverse primer; 2 μL of DNA template and 8.5 μL Nuclease free water. The primer sequence: mec A F: CTGCTATCCACCCTCAAACAG, mec A R: TCTTCGTTACTCATGCCATACA. The cycling condition was as follow; Initial denaturation at 94°C for 5 minutes, followed by 36 cycles of denaturation at 94°C for 30 seconds, annealing at 54°C for 30 seconds and elongation at 72°C for 45 seconds. Followed by a ?nal elongation step at 72°C for 7 minutes.

Statistical Analysis

The findings were analysed using International Business Machines (IBM) Statistical Package for the Social Sciences (SPSS) Statistic software for windows (SPSS statistical software V.21 (IBM Corp. 2019). Descriptive statistics were used to analyse socio-demographic details of all participants and presented in a table. Chi-square was used to compare the association between the history of recent antibiotics use and no history of antibiotic use with the independent variables. The p-value <0.05 were regarded as significant.

Results

Most of the clients were in their reproductive age group as shown in (Table/Fig 1). Their mean age was 34.65±6.48. Almost half of the participants had tertiary education while 6 (0.8%) had no formal education. Also, nearly half were traders. Civil servants contributed to 28.3% of the clients. Over 96.4 of the participants were married and 541 (75.9) clients visited the unit for the purpose of child spacing. Implant (Implanon and Jadelle) was the common type of contraceptive used by the clients (386, 54.1%).

(Table/Fig 2) represented the history of recent antibiotics use. Out of 59 (8.3%) clients who used antibiotics, only 1 (1.7%) obtained the drug from the hospital, 45 (76.3%) and 13 (22%) used the antibiotics inappropriately by self-medication and without prescriptions respectively. Over 86.4% of the antibiotic use was not supported by laboratory diagnosis or antimicrobial sensitivity assessment. The commonest indication for antibiotic use was a febrile illness, 43 (72.9) followed by sore throat, 15 (25.4%). Ciprofloxacin was the commonly used antibiotic, contributing to over half of all the antibiotics used by the participants. This was followed by amoxicillin-clavulanic acid.

The (Table/Fig 3) represents the gram reactions of all the isolates. The antibiotic sensitivity profiles of the isolated organisms were shown in (Table/Fig 4). Two out of nine Staphylococcus aureus were cefoxitin sensitive {Methicillin Sensitive Staphylococcus aureus (MSSA)}. Two Staphylococcus aureus each were Vancomycin Sensitive (VSSA) and Vancomycin Intermediate (VISA) respectively. Most of the organisms were sensitive to nitrofurantoin, linezolid, quinupristin/dalfopristin, and tigecycline. Almost all the isolates were resistant to quinolone. A total of 11 methicillin resistant Staphylococcus species were isolated and all of them expressed the mecA gene as shown in (Table/Fig 5).

(Table/Fig 6) showed the association between inappropriate use of antibiotics and age, level of education, and occupation of the client, and found no significant difference. The table also represented the relationship of uropathogens isolation and inappropriate antibiotic use. Uropathogens are more likely to be isolated from clients with a recent history of antibiotics use than those with no such history. There was a significant association (p-value=0.001) between inappropriate use of antibiotics and isolating MRSA.

Discussion

The burden of community acquired antibiotic resistance is increasing in developing countries because of the inappropriate use of antibiotics especially in the treatment of non bacterial infectious conditions such as upper respiratory tract infection, viral and parasitic febrile illnesses, and viral diarrhoeal diseases (13),(14). The choice of family planning clients as the study population was informed by their negligible contact with the healthcare environment as previously documented (15). The unit is often situated at the outpatient unit and sometimes outside the healthcare facilities where the clients have no contact with the patients (15). Also, the majority of the women who visit this facility were in their reproductive age group. In Nigeria, the commonest indication for contraception is child spacing (4). This means that many of the clients could seek for reversal of contraception to enable them to get pregnant. In present study, the participants were on their preconception visits (16).

This study observed that 24 (3.4%) of the participants had significant bacteriuria due to gram positive organisms with Staphylococcus aureus predominating. This finding obtained was similar to studies among pregnant women (17),(18). Studies have shown that ASB in pregnant women has over 50% chance of progressing to UTI but in non-pregnant adults, the probability reduces to 30% (16),(17),(18). The complication and the burden in terms of morbidity and mortality to both mother and child also increase with pregnancy. This is due to both hormonal and structural changes in the urinary tract due to pregnancy (19). No available study has shown the outcome of ABU in periconceptional women when they eventually become pregnant. Many physicians however screen and treat ABU in women expecting conception to prevent the detrimental complication associated with UTI in early pregnancy (19),(20).

Many studies in the country have reported increasing inappropriate use of antimicrobial (13),(14),(21), with a higher proportion occurring in the community where antibiotics are hawked without regulations (22),(23). As seen in present study, only one participant had her antibiotic prescribed in the hospital. This is against the World Health Organisation (WHO) recommendation and global action on the implementation of an antimicrobial stewardship program (24). Many have argued that such programs can only yield the desired result in developing countries when community participation is entrenched (5),(24). From most studies, the commonest indication for irrational use of antibiotics is febrile illnesses and upper respiratory tract infection (5),(24). Febrile illness in Nigeria is usually viral or parasitic in aetiology, and they do not require antibiotics. Antibiotics stewardship on the other hand requires that the indication for antimicrobial most be defined and evidenced-based. It should be supported by the appropriate laboratory investigation (5),(24). This was not the case in this study where only one participant had a doctors’ prescription, and few participants had a laboratory test before commencing antibiotics. Although the laboratory test is no longer recommended for the diagnosis of enteric fever (25).

Nigeria is one of the countries known for the misuse of fluoroquinolones (26). This involves unregulated access and availability of the drug and the use of substandard and spurious quality of oral ciprofloxacin formulations. It is thought that such use contributed toward increased risk of treatment failure and bacterial resistance in developing countries (26). The reason for the inappropriate use is high bioavailability, oral formulation, and ease to administer, and its broad-spectrum activity (26). In present study, ciprofloxacin was the commonly abused drug. Some studies highlighted that it is the second most misused drug in the country following closely the beta-lactams (ampicillin and amoxicillin) (27),(28). The beta-lactams have become the second with an amoxicillin-clavulanic acid, which has a broader spectrum of activity, preferred than ampicillin. This supports the observation by WHO that the world is exhausting its reserve of antibiotics (7).

These frequently irrationally used antibiotics are broad-spectrum, with the unfortunate ability to induce selective adaptation to multi-drug resistant strains and promote also promote their dominance and spread in communities. This is essential in areas with poor infection control (28). Ciprofloxacin and other fluoroquinolones are among the restricted antibiotics but its unregulated use could be responsible for its increasing resistance among the gram-positive, gram-negatives, Mycobacterium tuberculosis, etc., (28). In this study, multidrug resistant gram positive organisms were higher in the urine of the participants with a recent history of inappropriate use of antibiotics. Methicillin and quinolone resistant Staphylococcus were frequently isolated among this group. Also, isolate were vancomycin resistant Enterococcus species such findings have been widely reported in the hospital setting but rarely in the community. Their burden is enormous including increased hospital stay, cost, failure of treatment and increased side-effect (29). Clinicians usually consider the burden of resistant organisms in their choice of empirical treatment in healthcare associated infections, but such considerations are often not made on community acquired infections (29),(30).

Limitation(s)

As in all cross-sectional studies, other factors that contribute to antimicrobial resistant in the community many not have been assessed. Present study also did not assess the effect of the various contraception on the antimicrobial profile of the clients. Also, follow-up the women to know if the isolated organisms were transient colonisers of their UTI. However, the finding of this study will be vital in further investigation in the area.

Conclusion

Majority of the participants with the history of antibiotic use obtained the antibiotics without doctor’s prescription. Quinolone was frequently used antibiotics followed by amoxicillin-clavulanic acid. The commonest indication for antibiotic use was febrile illness. Methicillin resistant and quinolone resistant Staphylococcus and Enterococcus spp. bacteriuria were common among the participants with positive history of antibiotics use. There is need to regulate the use of antibiotics in the community through awareness and policy implementation.

Author’s contributions: CN supported the study design, led the analysis and drafted the paper; ECA participated in the data collection and helped with analysis; STC participated in the data collection and helped with analysis; PCN participated in data collection, analysis; NEM assisted in analysis and reviewed the draft paper; All authors read and approved the final manuscript.

Acknowledgement

Authors would like to thank the participants who gave consent for this study. Authors would also appreciate the field teams who coordinated Imanyikwa Eucharia Oluchi for administering the sample collection, and Onuabuchi Gift Chimnaecherem who helped in Statistical analysis.

References

1.
Procop GW, Church DL, Hall GS, Janda WM. Koneman’s Color Atlas and Textbook of Diagnostic Microbiology. Jones & Bartlett Publishers; 2020.
2.
Czekaj T, Ciszewski M, Szewczyk EM. Staphylococcus haemolyticus- An emerging threat in the twilight of the antibiotics age. Microbiology. 2015;161(11):2061-68. [crossref] [PubMed]
3.
Hay SI, Rao PC, Dolecek C, Day NP, Stergachis A, Lopez AD, et al. Measuring and mapping the global burden of antimicrobial resistance. BMC Medicine. 2018;16(1):01-03. [crossref] [PubMed]
4.
Ayukekbong JA, Ntemgwa M, Atabe AN. The threat of antimicrobial resistance in developing countries: Causes and control strategies. Antimicrobial Resistance & Infection Control. 2017;6(1):01-08. [crossref] [PubMed]
5.
Akinyandenu O, Akinyandenu A. Irrational use and non-prescription sale of antibiotics in Nigeria, a need for change. J Sci Innov Res. 2014;3(2):251-57. [crossref]
6.
Asogwa IE, Offor SJ, Mbagwu HO. Knowledge, attitude and practice towards antibiotics use among non-medical university students in Uyo, Nigeria. Journal of Advances in Medical and Pharmaceutical Sciences. 2017:01-01. [crossref]
7.
Shrivastava SR, Shrivastava PS, Ramasamy J. World health organization releases global priority list of antibiotic-resistant bacteria to guide research, discovery, and development of new antibiotics. Journal of Medical Society. 2018;32(1):76. [crossref]
8.
Ajibola O, Omisakin OA, Eze AA, Omoleke SA. Self-medication with antibiotics, attitude and knowledge of antibiotic resistance among community residents and undergraduate students in Northwest Nigeria. Diseases. 2018;6(2):32. [crossref] [PubMed]
9.
Ralston SH, Penman I, Strachan M, Hobson R, editors. Davidson’s Principles and Practice of Medicine E-Book. Elsevier Health Sciences. 2018.
10.
Izuchukwu KE, Oranu EO, Bassey G, Orazulike NC. Maternofetal outcome of asymptomatic bacteriuria among pregnant women in a Nigerian Teaching Hospital. Pan African Medical Journal. 2017;27(1). [crossref] [PubMed]
11.
European Committee on Antimicrobial Susceptibility Testing. Routine and extended internal quality control for MIC determination and disk diffusion as recommended by EUCAST. Search for latest version at http://www. eucast. org. 2019.
12.
Pinsky BA, Samson D, Ghafghaichi L, Baron EJ, Banaei N. Comparison of real-time PCR and conventional biochemical methods for identification of Staphylococcus lugdunensis. Journal of Clinical Microbiology. 2009;47(11):3472-77. [crossref] [PubMed]
13.
Efunshile AM, Ezeanosike O, Nwangwu CC, König B, Jokelainen P, Robertson LJ. Apparent overuse of antibiotics in the management of watery diarrhoea in children in Abakaliki, Nigeria. BMC Infectious Diseases. 2019;19(1):01-07. [crossref] [PubMed]
14.
Auta A, Banwat SB, David S, Dangiwa DA, Ogbole E, Toranyiin AJ. Antibiotic use in some Nigerian communities: Knowledge and attitudes of consumers. Tropical Journal of Pharmaceutical Research. 2013;12(6):1087-92. [crossref]
15.
Andreoli L, Bertsias GK, Agmon-Levin N, Brown S, Cervera R, Costedoat-Chalumeau N, et al. EULAR recommendations for women’s health and the management of family planning, assisted reproduction, pregnancy and menopause in patients with systemic lupus erythematosus and/or antiphospholipid syndrome. Ann Rheum Dis. 2017;76(3):476-85. [crossref] [PubMed]
16.
Akadri AA, Odelola OI. Progestogen-only injectable contraceptive: Acceptor prevalence and client experience at Sagamu, Nigeria. Nigerian Postgraduate Medical Journal. 2017;24(3):178. [crossref] [PubMed]
17.
Nteziyaremye J, Iramiot SJ, Nekaka R, Musaba MW, Wandabwa J, Kisegerwa E, et al. Asymptomatic bacteriuria among pregnant women attending antenatal care at Mbale Hospital, Eastern Uganda. PloS One. 2020;15(3):e0230523. [crossref] [PubMed]
18.
Nicolle LE. Asymptomatic bacteriuria. Current Opinion in Infectious Diseases. 2014;27(1):90-96. [crossref] [PubMed]
19.
Raji HO, Suleiman ZA, Abdulkadir ZA, Abdulrahman A. Caesarean section in a primigravida with spina bifida occulta and a spinal cord stimulator: Preconception counselling, antenatal care and anesthetic considerations. Tropical Journal of Obstetrics and Gynaecology. 2018;35(2):192-95. [crossref]
20.
Alemayehu A, Alemayehu M, Arba A, Abebe H, Goa A, Paulos K, et al. Predictors of neonatal sepsis in hospitals at Wolaita Sodo Town, Southern Ethiopia: Institution-based unmatched case-control study, 2019. International Journal of Pediatrics. 2020;2020. [crossref] [PubMed]
21.
Yusuf I, Jobbi YD, Arzai AH, Shuaib M, Ahmad AS. Self-medicated broad spectrum antibiotics in rural communities in Kano-Nigeria: A cross-sectional survey. African J Biomed Res. 2019;22(3):249-56.
22.
Abubakar U, Tangiisuran B. Knowledge and practices of community pharmacists towards non-prescription dispensing of antibiotics in Northern Nigeria. International Journal of Clinical Pharmacy. 2020;42(2):756-64. [crossref] [PubMed]
23.
Uzochukwu BS, Onwujekwe OE, Okwuosa C, Ibe OP. Patent medicine dealers and irrational use of medicines in children: The economic cost and implications for reducing childhood mortality in Southeast Nigeria. PLoS One. 2014;9(3):e91667. [crossref] [PubMed]
24.
Israel EU, Emmanuel EG, Sylvester EG, Chukuma E. Self-medication with antibiotics amongst civil servants in Uyo, Southern Nigeria. Journal of Advances in Medical and Pharmaceutical Sciences. 2015:89-97. [crossref]
25.
Enabulele O, Awunor SN. Typhoid fever in a tertiary hospital in Nigeria: Another look at the widal agglutination test as a preferred option for diagnosis. Nigerian Medical Journal: Journal of the Nigeria Medical Association. 2016;57(3):145. [crossref] [PubMed]
26.
Sharma D, Patel RP, Zaidi ST, Sarker M, Rahman M, Lean QY, et al. Interplay of the quality of ciprofloxacin and antibiotic resistance in developing countries. Frontiers in Pharmacology. 2017;8:546. [crossref] [PubMed]
27.
Olayemi OJ, Olayinka BO, Musa AI. Evaluation of antibiotic self-medication pattern amongst undergraduate students of Ahmadu Bello University (Main Campus) Zaria. Res J Appl Sci Eng Technol. 2010;2(1):35-38.
28.
Budd E, Cramp E, Sharland M, Hand K, Howard P, Wilson P, et al. Adaptation of the WHO essential medicines list for national antibiotic stewardship policy in England: Being AWaRe. Journal of Antimicrobial Chaemotherapy. 2019;74(11):3384-89. [crossref] [PubMed]
29.
Mughini-Gras L, Dorado-García A, van Duijkeren E, van den Bunt G, Dierikx CM, Bonten MJ, et al. Attributable sources of community-acquired carriage of Escherichia coli containing β-lactam antibiotic resistance genes: A population-based modelling study. The Lancet Planetary Health. 2019;3(8):e357-69. [crossref]
30.
Merli M, Lucidi C, Di Gregorio V, Falcone M, Giannelli V, Lattanzi B, et al. The spread of multidrug resistant infections is leading to an increase in the empirical antibiotic treatment failure in cirrhosis: A prospective survey. PLoS One. 2015;10(5):e0127448. [crossref] [PubMed]

DOI and Others

DOI: 10.7860/JCDR/2022/52980.16898

Date of Submission: Oct 22, 2021
Date of Peer Review: Dec 03, 2021
Date of Acceptance: Jan 03, 2022
Date of Publishing: Sep 01, 2022

AUTHOR DECLARATION:
• Financial or Other Competing Interests: None
• Was Ethics Committee Approval obtained for this study? Yes
• Was informed consent obtained from the subjects involved in the study? Yes
• For any images presented appropriate consent has been obtained from the subjects. NA

PLAGIARISM CHECKING METHODS:
• Plagiarism X-checker: Oct 26, 2021
• Manual Googling: Dec 14, 2021
• iThenticate Software: Aug 08, 2022 (9%)

ETYMOLOGY: Author Origin

JCDR is now Monthly and more widely Indexed .
  • Emerging Sources Citation Index (Web of Science, thomsonreuters)
  • Index Copernicus ICV 2017: 134.54
  • Academic Search Complete Database
  • Directory of Open Access Journals (DOAJ)
  • Embase
  • EBSCOhost
  • Google Scholar
  • HINARI Access to Research in Health Programme
  • Indian Science Abstracts (ISA)
  • Journal seek Database
  • Google
  • Popline (reproductive health literature)
  • www.omnimedicalsearch.com